جستجوی مقالات مرتبط با کلیدواژه « نژاد » در نشریات گروه « گیاهپزشکی »

Citrus tristeza virus (CTV) is one of the most devastating citrus diseases in Iran. The CTV genome is a positive single-stranded RNA molecule with a size of 19.3 kb containing 12 open reading frames (ORFs). CTV encodes two different coat proteins, of which the small coat protein (CPm) covers only the 3' end of the genome. CTV infected trees show symptoms such as stunting, yellows, reduced vigor and death. In addition, CTV generates three typical disease syndromes, including quick decline, stem pitting and seedling yellows. In total, more than 259 thousand hectares of citrus are grown in the north and south of Iran. Considering the lack of the complete genome sequence of Iranian CTV isolates and the different climatic conditions in citrus cultivation in the north and south of Iran, the genome of CTV isolates from Iran was determined for the first time and their phylogenetic relationships with other CTV isolates were studied.

In spring and fall 2015, 30 samples from Mazandaran province in northern Iran and 25 samples from Fars province in southern Iran were collected from trees suspected of being infected with CTVs. Total RNA was extracted using the RNX-Plus kit according to the manufacturer's instructions. CTV was identified using the specific primer pair CPF (5¢AAAGAAGGCGACGATGTTGT3¢) and CPR (5¢AGCTCCGGTCCAAGAAATCTG3¢) designed based on the coat protein gene of CTV. Reverse transcription was performed using MMuLV reverse transcriptase (Pars Tuos, Iran) and PCR reaction was performed using Amplicon 2x PCR Master Mix (Amplicon, Denmark). Infected samples were grafted onto sour orange seedlings. sRNAs were extracted using a protocol developed by Carra et al. (2006), and sRNA libraries were prepared according to the CATS protocol (Turchinovich et al., 2014). One microgram of each library was sequenced on the Illumina HiSeq2500 platform from Macrogen, South Korea. The CTV strains were determined by virtual replication and digestion or alignment of the region between the small coat protein (Cpm) and coat protein (Cp) genes. The phylogenetic tree was constructed by the maximum likelihood method using the T92+I nucleotide substitution model with 500 bootstrap repeats by MEGA7. The nucleotide and amino acid similarity matrix was calculated using SDTv.1.2 software. Potential recombination events in the genome were determined using RDP v.5.5.

CTV infection was detected in 17 samples from Mazandaran province (56% of samples) and in 8 samples from Fars province (33% of samples) using a CPF/R-specific primer pair. CTV symptoms were mild to severe stunting, chlorosis, yellowing, vein yellowing, and severe decline in the citrus samples from the north of Iran, while CTV symptoms in the samples from the south of Iran were stunting, chlorosis, dieback and quick decline. Three months post inoculation, symptoms of severe stunting and chlorosis appeared in seedlings inoculated with isolates from the north, while mild stunting and yellowing appeared in seedlings of sour orange inoculated with CTV isolates from the south. By assembling the contigs obtained from the RNA-seq data, the complete genomes of IR-North1, IR-North2, IR-South1, and IR-South2 isolates were reconstructed with lengths of 19296, 19302, 19252, and 19251 nucleotides, respectively. The Iranian CTV isolates had nucleotide similarity in the range of 95.2-77.5% with other CTV isolates deposited in GenBank. The polymerase, P65, and coat protein genes of the Iranian CTV isolates showed identity at the amino acid level of 80.6-94.1%, 88-93.9%, and 92.4-96.4%, respectively, with other CTV isolates. Analysis of the CTV strains revealed that IR-North1 resembles the severe decline strain belonging to genotypic group T36, while IR-South2, IR-North2, and IR-South1 belong to the stem pitting and seedling yellows strains of genotypic group VT/T3 and are similar to strains T3, SY, and T318A, respectively. In the phylogenetic tree based on the full length of the CTV genome, three subclades were designated: VT, T68, and T36. IR-North2, IR-South1, and IR-South2 isolates were grouped into VT, and IR-North1 isolate was grouped into T36. Like the reference CTV isolate, the four Iranian CTV isolates had 12 open reading frames. Examination of the Replicase, RdRp, P65, P61, CPm, and CP proteins revealed 280 amino acid substitutions in 33 conserved motifs in Iranian CTV isolates. The isolate IR-North1 had only five substitutions; however, 97, 85, and 93 substitutions occurred in the isolates IR-North2, IR-South1, and IR-South2, respectively. Most substitutions were found in the replicase and p61 proteins, which are involved in virus replication and assembly, respectively. RdRp and p23 proteins had the least amino acid substitutions. No known conserved motif was observed in P33, P6, P18, P13, and P20 proteins. In addition, IR-North1, IR-North2, and IR-South1 were recombinant. In IR-North1, 1426 nucleotides in the P65 gene and 773 and 2444 nucleotides in the replicase gene were recombinant in IR-North2 and IR-South1 isolates, respectively.

An analysis of symptoms, nucleotide diversity, dominant strains, and the phylogenetic relationship of the four Iranian CTV isolates sequenced in this study revealed that two isolates from northern Iran were quick decline and seedling yellows strains, falling within the genotypic groups T36 and VT. These groups were distinguished by distinct symptoms and a separate phylogenetic position. Conversely, the two southern CTV isolates were closely associated with CTV stem pitting strains, classified into genotypic groups VT and T3, sharing a close phylogenetic position.

Soybean cyst nematode (Heterodera glycines) is the most important factor in reducing the yield of soybean crop (Glycine max) in most of its cultivated areas in the world and is also spread in Iran in Mazandaran and Golestan provinces. In the present study, the reaction of 100 genotypes and soybean cultivars in the seed bank of Oilseeds Research and Development Company to soybean cyst nematode was evaluated. Genotypes were studied in a randomized complete block design with three replications under constant greenhouse temperature conditions. The race of soybean cyst nematode population was determined and identified using differential soybean cultivars. The results showed that 12 genotypes among Leflor, Bedford and Forrest as resistant ; three genotypes including Chiquita, Centennial and Cloud as moderately resistant ; 26 genotypes as moderately sensitive and 59 genotypes namely Essex, Faur and Clark In addition susceptible check (Jk cultivar) as highly sensitive genotype to race 3 of soybean cyst nematode were identified. The results of cluster analysis based on nematode resistance, maturity group, seed color and umbilical color divided the genotypes into five groups. The most susceptible genotypes were in the second cluster group and the most resistant genotypes were in the third cluster group. Also, most of the resistant genotypes in terms of soybean maturity group belonged to groups V and VI of the maturity group.

 In this study, ninety- six isolates of Pyrenophora tritici-repentis from Ardabil province were collected and identified. According to the results of molecular data and considering the geographical area, thirty isolates were selected for race identification studies in greenhouse. Genetic diversity was detected between three fungal populations including Parsabad, Germi and Bilesavar in Ardabil province. During the study of gene diversity, the amount of gene flow (Nm) was equal to 1.6890 and the amount of Gst was equal to 0.2284. The rate of genetic diversity for the whole population (Ht) was 0.2993. PhiPT was estimated to be 0.259 (p> = 0.010). According to the results of AMOVA, 74% of total variance was attributed to within populations while only 26% of that was related to between populations. Race1 of the pathogen as the main race was used in Ardabil province to evaluate the resistance of forty wheat cultivars in greenhouses. Inoculation was carried out using fungal conidial suspensions and fungal culture filtrates. The Mean Disease Index in different cultivars was calculated and compared. The results of cultivars' reaction showed that 90% of studied wheat cultivars are in the susceptible group to the pathogen. Four cultivars of Morvarid, Moghan 3, Ehsan and Darya, which together comprise 10% of the studied cultivars, were included in the resistant group. The use of these resistant cultivars is recommended for areas with a high possibility of disease outbreaks. In addition, breeders can use the sources of resistance for future breeding programs.

Annual survey for monitoring of reaction of commercial wheat cultivars to stripe rust disease is very important after their introduction and extensive cultivation. The host materials surveyed included the standard differential cultivars for stripe rust along with 24 and three respectively commercial bread and durum wheat cultivars. This study was accomplished in selected wheat fields of six regions of Fars province including Zarghan, Marvdashat, Fassa, Mammassani, Darab and Eghlid during 2003- 2005 and in two stripe rust nurseries in Zarghan and Mammassani during 2003- 2013. The results showed that the resistance of 12 cultivars including Chamran, Shirodi, Shiraz, Darab 2, Falat, Star, kavir, Zarin, Shahriar, Alvand, Alemot and Bahar was overcome by stripe rust during or before the last decade. Yavarous and several recently introduced cultivars including Zareh, Mihan, Siravan, Chamran 2, Ophogh, Behrang and Shabrang have conferred moderately to intermediate resistance reaction to the disease. The cultivars Sivand, Parsi, Pishgham, Marvdasht and Aflak showed a range of moderately resistance to moderately susceptible reaction. The response of Pishtaz varied from moderately susceptible to resistance. Nicknejad has shown to have high level of resistance since its long time introduction. Decrease or changes in the resistance of some of the cultivars can be attributed to changes in stripe rust races, weather conditions and environmental factors. In this regard among the differential cultivars, virulence was almost present for Yr2, Yr6, Yr7, Yr9, Yr17, Yr25, Yr26, Yr27, YrA and YrSU. Current research indicates that annual survey on responses of commercial wheat cultivars to stripe rust together with monitoring of pathogen virulence factors in Fars province are very necessary. These information not only can effectively aid in giving on-time warning to replace susceptible cultivars and to use effective control measures to reduce the loss of the disease, but also can play an important role in short and long time wheat breeding programs.

Yellow rust or stripe rust is the most prevalent fungal disease in Iran and also different regions of the world. Therefore, it is necessary to study and identify the properties of different races of this fungal pathogen. For this purpose, 29 Pst isolates collected from different regions of Iran, were tested at the seedling stage using 44 differancial lines and the susceptible cultivar Bolani.. The seedlings were inoculated with the pathogenic isolates. After 17 days, notes were taken using Johnson et al method, and the races were determined. According to the results, pathogenicity was detected for the plants carrying the gene YrA all isolates. No pathogenicity was recorded for the plants carrying the genes Yr5, Yr10, Y15, and YrSP in this study. The races 132E156A,Yr27 of Ahvaz 3 and the race 2E2A of Mashhad were identified as the most and least agreesive races, respectively.

Soybean cyst nematode, Heterodera glycines, is widespread in major soybean producing countries and is considered as the most suppressed agent of soybean yield in the world. This nematode was reported from northern Iran in 1999 for the first time. Presently SCN is widely distributed in Golestan and Mazandaran provinces and infestation rate is a remarkable showing broad range of infestation. In most fields, the population density is above the damage threshold level reported for this nematode in the literatures. The HG Type 0 (race 3) has been defined as the dominant type in the region and Katoul (DPX) is the only resistant cultivar to this type of SCN in Iran. Importance of soybean cyst nematode, distribution and severity of infection, nematode morphology, symptoms, race/Hg Type, life cycle, reaction of Iranian cultivars against the dominant SCN Hg Type in Iran, and its management, based on the researches conducted in Iran and in the world are presented in this paper.

Blight disease of chickpea caused by Ascochyta rabiei (Pass.) Lab.is one of the most important chickpea diseases in the world and Iran, which causes huge damages to chickpea farm in the suitable climatic conditions. Study of genetic diversity and various races exist in the different regions would be necessary for resistant cultivars development. In this research physiological races of 28 isolates of A. rabiei which were collected and purified from five region of Kermanshah province during 2012-2013 were determined using seven differential chickpea cultivars (ILC-202, ILC-1929, ILC-5928, ICC-3996, ILC-194, ILC-1929 and ILC-72). All isolates were classified in six physiological races. Among the all isolates, seven isolates (25%) belonged to race 1, Five isolates (17.8%) belonged to race 2, Seven isolates (25%) belonged to race 3, Four isolates (14.4%) belonged to race 4, two isolates (7.2%) belonged to race 5 and three isolates (10.6%) belonged to race 6. Races 1, 2, 3 and 4 with 23 isolates (82.1%) were occurred in all areas of the province while race 6 with high virulence was detected only in one area (Sararood). Investigation of the morphological traits of isolates on CSA (Chickpea sucrose Agar), showed differences in view of diameter, color and form of colony, pycnidium density and pycnidium size among the isolates, but there was not any difference in term of pycnidiospore size.

ISSR molecular marker, in order to isolate the Iranian native Bombyx mori silkworm breeds were used. Extracted DNA by using phenol-chloroform was performed. The qualitative and quantitative measurements of extracted DNA and its dilution, was obtained from the bands on 1.5% agarose gel and they marked and analyzed. The results showed that the observed bands were between 200-1000 bp and the most bands were observed corresponding to Harati-yellow with 32 bands and Khorasani-lemon had their lowest with 25 bands. Second Primers were the highest number of bands with 43 bands and thefourth primer had the lowest number of bands with 30 bands. Cluster analysis of races, placed them in three main groups. The first groups consisted of Gilani-orange, Harati-yellow and Khorasani-pink, Khorasani-lemon and Baghdadi races placed in seprate groups. In cluster analysis, Gilani-orange showed the most similar to Herati-yellow and this two races with khorasani-pink were the first group. The most genetic similarity were between Gilani-orange and Herati–yellow and the most genetic distance was obtained between Baghdadi and other four races. It is concluded that, ISSR marker can seperate differentraces of silkworm with different origin very well.there fore to approve the it is suitalle to use more than more than 30 primer for 14 silkworm individuals with 2n= 28 is better.

Pathogenicity of wheat stem rust was investigated during two cropping seasons of the years 2010 and 2011. towards this end, 47 isogenic lines of wheat stem rust along with 43 cultivars/lines of the crop were tested in field conditions (natural infection) and also in the greenhouse conditions. The results showed, similarity of pathogenicity for plants carring gene/s Sr7B, Sr8A, Sr8B, Sr9B, Sr9D, S9G, Sr11, Sr13, Sr16, Sr17, Sr25, Sr34 and SrDP2 as for two isolates. As for the in genetic variation of two wheat stem rust isolates (in greenhouse conditions), Kelardasht isolate did not show virulence for 15 isogenic lines carrying gene/s Sr5, Sr8A, Sr22, Sr24, Sr26+Sr9G, Sr27, Sr28, Sr29, Sr31, Sr32, Sr33, Sr35, Sr36, SrGT and SrWLD. From Dashte-Azadegan isolate of Khuzestan, virulence for gene Sr31 as a variant of Ug99 race was detected, while this isolate being avirulent on plants carrying gene/s Sr5, Sr22, Sr24, Sr26+Sr9G, Sr27 and SrGT. The results of evaluation of resistance for commercial wheat cultivars and elite lines indicated that, such new released cultivars as Morvareid, Sivand and Parsi were resistant with a range of reaction of 5R-50M to stem rust diseases as observed during the two years of the study.

To study Virulence and molecular polymorphism variation of Puccinia striiformis Westend. f.sp.tritici Eriks. (Yellow rust disease agent) in Iran, 86 isolates were collected from all around the country. Race determination was carried out according to Johnson et al. (1972) method. In addition, isolates were analyzed by AFLP method by Four primer combinations. According to the results of race determination, 35 Physiological races were identified. Race 178E0A- with 7 members was the most frequent followed by Race 64E241A+ with 5 members. Virulence was not detected on the commercial cultivars having Yr1(Except for 4 Isolates), Yr3, and Yr5 genes. Virulence for Yr2, Yr24, Yr7 and YrA was detected in all around the country. In average for every Primer combination 78 bands were recorded that 30 percent of them were polymorphic. Analysis of data by NTSYS software grouped all isolates in 9 main groups as A, B, C, D, E, F, G, H and I, and 10 single isolates groups in 77% similarity coefficient. There was significant relationship between geographic origins and AFLP fingerprinting groups. However there were not certain relationship between races and these groups.Genetic similarity between most of populations and West/Northwest population (contain Ilam, Hamadan, Kermanshah and Ardebil provinces) was more than 65%. This similarity may be because of Sudanian and mediteranian flows in transferring of spors from Northwest of Iran to North and Southwest of Iran and concluded to a gene flow.