فهرست مطالب kh talebi

 The cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a significant agricultural pest in arable lands and on ornamental crops in temperate regions of the world and has been shown to be capable of developing resistance to many classes of insecticides. Difficulties in controlling B. tabaci mainly result from its resistance to insecticides, including neonicotinoids. Neonicotinoids are a relatively new class of synthetic insecticides used primarily to control of whiteflies, B. tabaci is capable of developing resistance to different classes of insecticides as neonicotinoides. It has been experimentally proven that resistance of B. tabaci to imidacloprid is associated with overexpression of the P450 genes. RNA interference (RNAi) has been successfully applied in insects to study RNAi mechanisms and gene functions. In this study, the RNA interference (RNAi) effects of P450 CYP6CM1 as key gene in resistance to neonicotinoides on expression, resistance ratio and total P450 activities were evaluated. Colony of whitefly reared on leaves of tomato plants in growth chamber at 25 ± 2 ºC, 65±5% RH and a photoperiod 16:8 h (light: darkness). Total RNA was isolated from adult B. tabaci using Biosol reagent (Invitrogen). cDNA synthesis was performed using iScript cDNA Synthesis Kit (BIO-RAD). Double-stranded RNA (dsRNA) of P450 CYP6CM1 was synthesized using specific primers (3' TAATACGACTCACTATAGGG 5', 3' TAATACGACTCACTATAGGG 5'), the bioassay tests after introduce of dsRNA into the insect body of whitefly by oral delivery were carried out for 6 days, and mortality was recorded daily by counting the dead insects at the bottom of the tube. The LC50 and resistance ratio were calculated using Ploplus computer software. The amount of cytochrome P450 activity was measured using 7-ethoxycoumarin based on the microfluorimetric method. Quantification of mRNA expression levels was quantified using the comparative cross-threshold (CT) (the PCR cycle number that crosses the signal threshold) method. Analysis of knockdown effects of CYP6CM1 on resistance was based on probit analysis and indicates that the gene is responsible for up to 5.3-fold reduction in imidacloprid resistance of dsRNA-fed adults. Moderate, but significant reduction in total P450 activity (45 %) exhibited by microsomal proteins prepared from dsRNA-fed JR population adult when compared to the control (JR population without dsRNA-fed). The results of P450 CYP6CM1 mRNA expression levels showed decrease in mRNA levels of the target genes with increasing the time after feeding dsRNA. Results revealed that delivery dsRNA to adult insect's reduced CYP6CM1 expression up to 2 -fold when comparing to the control. Reduction in resistance ratio by 5.3 fold after CYP6CM1 dsRNA fed in resistance population indicated the possibility of practical use of RNAi technique in insect resistance management (IRM).

Recently, the use of plant essential oil as natural compound for protecting crops and decreasing environmental pollutions has been considered. In this study, contact and fumigant toxicity of peel essential oil of Citrus sinensis singly and in combination with spirodiclofen and propergite were evaluated against adult females of two-spotted spider mite, Tetranychus urticae. Median lethal concentration (LC50) values of essential oil of orange peel in the contact and fumigant toxicity assay, were 11.48 μg/cm2 and 48/75 μl/l air, respectively. Contact toxicity of C. sinensis essential oil in comparison with the two chemical compounds showed that T. urticae was more sensitive to spirodiclofen (LC50= 2.76 μg/cm2) than the essential oil, while propargite was less efficient (LC50= 28.51 μg/cm2). Furthermore, mixture of propargite and essential oil of orange peel (both at LC25) showed a mortality less than the total expected mortality (50 %). In contrast, mortality of LC25 of spirodiclofen mixed with C. sinensis essential oil was much higher than that of the total expected mortality (96.66 %). According to co-toxicity coefficient (CTC) factor, mixtures of C. sinensis essential oil with propargite and spirodiclofen, exhibited antagonistic and synergistic effects, respectively.

Most areas of plain regions in Mazandaran province are planted with rice, and different pesticides and fertilizers are used at high densities to increase the yield of production. Diazinon is the main insecticide that being used to control Chilo supressalis Walker. The main problem is the high groundwater table in the region, and consumption of this water by local people and anthropogenic side effects of water pollutants. This study has focused on the quality of groundwater with an emphasis on water in shallow wells. Water sampling from 10 shallow wells located in seven villages was carried out during summer and autumn of 2006. A one-liter sample was taken from each of the wells in amber glass bottles and was carried to the laboratory. Residues extraction from samples was done using dichloromethane liquid-liquid method, and clean-up was done on thin layer plates. The residues of insecticide in samples were determined by high performance liquid chromatography (HPLC). The used column was in 150×6 mm, and mobile phase was methanol and water with the ratio of 70:30 v:v, at flow rate of 1.250 ml/min. Detection was done using UV detector at 220 nm. The results of study showed that the residues of diazinon in groundwater of Mahmoud Abad area was 0.002 to 0.572? gl-1.In some samples the concentration of diazinon residues in water samples was higher than WHO maximum residue limits (0.1?gl-1).

Vegetable crops are exposed to repeated spraying against the pests and diseases during the growing sessions. Crops such as greenhouse cucumber are usually harvested a short time after spraying, bearing a high level of pesticides with them. This fact justifies a research on this problem. This research was carried out to determine the effects of metalaxyl (a fungicide commonly used in greenhouse) residue in cucumbers grown under traditional and modern greenhouse conditions. Cucumber plants were sprayed with two different doses: 1/1 000 and 2/1000 metalaxyl in modern and traditional greenhouses. Samples were collected 1, 2, 4, 7, 10, 14, 21 and 28 days after spraying with metalaxyl. The fungicide residue was extracted, cleaned up by TLC and the final solution was analyzed by HPLC. Data were analyzed statistically by t-test (paired observations) and Duncans multiple range test. The results revealed that the amount of metalaxyl residues increased in the first four days following spraying. This amount of the residue was 10 times higher than MRL (0.5 mg/kg), while a lower level of MRL (0.5 mg/kg) was detected 21 days after the application. Results also showed that a lower dose of application left a higher residual level than the higher one. On the other hand, no significant differences (p<0.05) were found between the amounts of residues in peeled and unpeeled cucumbers. Thus, fruit peeling does not reduce the fungicide residue in cucumber. Also, there were no significant differences (p<0.05) between the results obtained from modern and traditional greenhouses. Therefore, cucumber must either be harvested before or at least 14 days after spraying with metalaxyl.

In this research, the presence of metalaxyl residues was studied in field-grown cucumber. Two different formulations of metalaxyl were used in the experiments. In the first experiment, cucumber plants were sprayed once and repeatedly by Ridomil-MZ 72 WP at 2.5 g/litre. In the second experiment, single and double applications of metalaxyl granule 5G were carried out at 5 g/m2. Leaves and fruits were sampled at different times after each treatment and analyzed for metalaxyl residues by HPLC. In leaf samples from single sprayed plots, metalaxyl residues declined rapidly following the treatment and more than 50% of the residues disappeared in the first two days, whereas in the leaf from single granule-applied plants, the residues increased during the first three weeks and then declined. Metalaxyl residues in cucumber sampled from single sprayed-plots were at a high level during the first three days after the spray and declined below the MRL (0.5 mg/kg) on the 7th day. In granule-applied plots, the residues increased during the first 7 days and the level below the limit was recorded 20 days after application. Residual values for plants sprayed with suspension showed a faster dissipation rate than granulated treatment. Metalaxyl recovered after three times of spraying and two times of granular application did not show any toxic accumulation of residues in fruit.

During recent years, worldwide concern has been focused on the potential for contamination of surface waters and ground waters by agrochemicals in runoff and soil water from irrigated fields. Given this perspective, it is very important to correctly evaluate the levels of different agrochemicals in water, both from human toxicological and environmental viewpoints and to develop management strategies for reducing agrochemical loads to acceptable levels in the environment. The main objective of this study was to assess the qualitative changes of tailwater due to the use of agrochemicals and thereby to determine contamination loads. Four farms (A, B, C and D) were chosen in the Foumanat region in the F2 unit in 1996. The areas of these fields ranged from 0.22 to 0.6 ha having a number of unequal successive basins with variable inflow and outflow rates. A quantitative analysis showed that the tailwater ratio in farms A, B, C and D ranged from 2 to 64% during the irrigation season. The outflow water was classified as C3S1. The changes in qualitative factors were not significant and did not follow any certain pattern during the irrigation season. The changes in SAR, EC, Cu, Zn, B, P, K and DO in the inflow and outflow waters were also insignificant. After fertilizer application, the increase in nitrogen concentration in the outflow was significant. The average pollution loads in the inflow and outflow were about 1618 and 1476 kg/day/ha, respectively. The remaining load in the rice fields was about 142 kg/day/ha, which was meaningful at 1% level. The fifth farm (E) located in Lahidjan was sprayed with diazinon. Water samples were analyzed each day for diazinon residues for 10 days after application. Sample analysis showed that the concentration of the insecticide was 93.08 mg/l immediately after application and gradually reduced to 0.98 mg/l ten days after spraying.