فهرست مطالب samad jamali

An isolate of an ascomycetous fungus collected during a field trip in the Zagros Forest, Kermanshah province (West of Iran) was identified as Myxotrichum. Based on the morphological and molecular characters the isolate was identified as M. deflexum. Genomic DNA was extracted and a nuclear rDNA region, containing the internal transcribed spacers 1, 2 and 5.8S gene of rDNA (ITS) were amplified and PCR product was sequenced. Amplicon was purified, sequenced and submitted to the GenBank (Acc. No. OR047187). The BLAST search results showed highest similarity of this isolate to other isolates of M. deflexum from GenBank. By reviewing the literature on ascomycetous fungi, Myxotrichum is found as a new genus for the funga of Iran.

Accurate identification of the host species is critically important for disease detection and informing appropriate disease management decisions. Paecilomyces formosus, a causal agent of dieback and decline of oak, is an emerging threat that may cause severe risk to the Zagros forests of Iran in the future. In this study, a nested PCR assay for the identification of P. formosus was developed with the species-specific primer pairs PaMF and PaMR designed from the comparisons of nucleotide sequences of the nuclear ribosomal DNA internal transcribed space regions (ITS) from P. formosus isolates and other closely related taxa. To accomplish this, we sampled forest trees with dieback symptoms in Kermanshah and Ilam provinces. The Paecilomyces isolates were identified based on morphological characteristics, acid production on keratin sucrose agar medium, and sequencing of the ITS-rDNA region and part of the beta tubulin gene. Nested PCR was successfully amplified a 441 bp product exclusively from P. formosus genomic DNA, and no cross-reactions were observed with any other species, and also P. variotii. The nested PCR method can detect 100 fg of P. formosus genomic DNA. Sixty of symptomatic forest trees from seven locations in Zagros foreste were assayed, resulting in the discovery of Amygdalus lycioides, Cerasus avium, Cerasus microcarpa, Quercus libani, Acer spp., Acer monspessulanum, Ficus carica, Ziziphus spina-christi, Tamarix ramosissima and Ziziphus spina-christi as new host species, and all seven infested areas. To fulfill Koch’s postulates, the experiments were carried out on detached branches and attached healthy branches of trees at the forests in Kermanshah and Ilam provinces, Iran. The PCR-based method developed here can be used for a fast and reliable diagnosis of P. formosus, monitoring the epidemics, and assessing management strategies in Zagros forests.

Desert truffles are hypogeous edible fungi from the Ascomycetes group that grow in arid and semi-arid areas of the Mediterranean region, including Iran. In addition to the economic role, they also play an important role in preserving and maintaining the ecosystem of rangelands from an ecological point of view by preventing erosion and desertification. In this study, the mycorrhizal association between the Terfezia claveryi Chatin (Cistaceae) with the perennial plant species Cistus ladanifer, C. laurifolius, Helianthemum lippii, and H. almeriense was investigated. The results of this study showed the mycorrhizal association as ect-endo mycorrhization with varying degrees of sheath development among the four investigated plant species. Mycorrhization rate and the relative mycorrhizal dependency (RMD) for T. claveryi/H. lippii combination was 87% and 48.18%, followed H. almeriense with mycorrhization rate and relative mycorrhizal dependency 80% and 17.92%, respectively. Growth parameters of the inoculated plants including plant height and weight, root height and weight, and shoot height and weight were statistically significant compared to control plants. The mycorrhizal relationship of T. claveryi with inoculated plant species was confirmed using Nested-polymerase chain reaction and specific primer pairs designed for this species from the sequence of the internal transcribed space regions.

Chickpea is a valuable and protein-rich pulse crop which is widely cultivated in more than 50 countries. Cultivation of chickpea in rotation with cereals can improve soil fertility through the process of symbiotic nitrogen fixation. Among the chickpea producing provinces in Iran, Kermanshah province has the first rank of chickpea production. Root rots and wilt have been considered the most devastating diseases limiting chickpea production in Kermanshah Province. However, the etiology of these diseases has not been thoroughly investigated. Therefore, the present study aimed to identify the fungal species causing wilt, yellowing and root rot in Kermanshah province, identify the dominant species and determine the prevalence of the disease in different regions of the province.

One hundred ninety-four chickpea fields, representative of the main planting areas throughout Kermanshah province, were surveyed during growing seasons 2011-2015. In each field, at least four diseased plant samples showing yellowing or wilting symptoms were collected, kept in paper bags, and transferred to the laboratory. 5 mm long pieces of root and stem of affected plants were prepared, surface sterilized and plated on Water Agar. The culture plates were incubated at a temperature of 25°C and examined on a daily basis. Pure cultures were obtained using either the hyphal-tip or single spore techniques. The isolates were then morphologically identified using available descriptions from the literature. Out of the abundant isolates, a total of 288 were selected for further investigation regarding their pathogenicity and aggressiveness. To prepare the inoculum, oat seeds were soaked in water for 24 hours and then transferred to 500 ml flasks. The flasks were autoclaved at a temperature of 121°C for 20 minutes, twice on two consecutive days. Each fungal isolate was cultured on five plates containing Potato Dextrose Agar (PDA) medium. Then, the autoclaved oat seeds were added to the plates. The plates were then incubated at 25°C for two weeks until the fungus completely covered the seeds surface. The pots (4 cm in diameter and 12 cm in height) were filled to a height of 6 cm with an autoclaved soil mixture (field soil / sand at a ratio of 2:1), then 2 ml of inoculum was applied to the soil surface, the inoculum was covered with one cm of autoclaved soil, the two seeds of chickpea cultivar, Bivanij were placed on the soil surface, Finally, the seeds were covered with 2 cm of soil. In this test, three replicates were considered for each isolate. The control pots were mock inoculated with uninfested oat seeds. The pots were kept in the growth chamber for a maximum of five to six weeks at 25-28 ° C. The disease severity was rated according to a 0-4 scale.

Based on morphological characteristics, eight fungal species including Fusarium oxysporoum, F. solani, F. equiseti, F. proliferatum, F. verticillioides, F. culmorum, Macrophomina phaseolina and Rhizoctonia solani were identified. Based on the results of pathogenicity test, except for F. verticillioides and F. culmorum other species were identified as pathogenic. Among these, F. oxysporum and F. solani species complex were classified as the most common and most aggressive pathogens. F. equiseti and F. proliferatum were ranked as weakly aggressive pathogens. In this study, vascular discoloration, a major characteristic of the pathogenic isolates of F. oxysporum, was observed in only a few inoculated plants suggesting that most of the recovered isolates did not belong to F. oxysporum f. sp. ciceri. Disease symptoms triggered by most of the isolates of F. oxysporum species complex in this study are consistent with those of F. redolens. However, accurate identification of these isolates requires a combination of molecular protocols and detailed morphological studies.

Our results showed that Fusarium species are the main agent causing root rot, yellowing and wilt on chickpea in kermanshah province. Among these, F. oxysporum species complex was the most common and most aggressive species. However, contrary to previous reports, most of the F. oxysporum isolates examined in this study did not belong to F. oxysporum f. sp. ciceri. Since the accurate pathogen identification is crucial for efficient disease management, accurate identification of the pathogen needs to be confirmed using molecular protocols. We also concluded that F. proliferatum is a weak pathogen of chickpea root. This is the first report of pathogenicity of F. proliferatum on chickpeas.

Take-all is one of the most important wheat diseases worldwide. The present study assessed the effect of nitrogen and phosphorus fertilizers, and endophytic fungus Microdochium bolleyi on controlling this disease in wheat ‘Pishgam’ cultivar for the first time. A greenhouse experiment was conducted based on a completely randomized design (CRD) with the treatments of control, nitrogen+phosphorus fertilizers (100 and 200 mg kg-1 urea, and 50 and 100 mg kg-1 triple superphosphate) alone and their combination with pathogen Gaeumannomyces graminis and endophytic fungus M. bolleyi. Then, root dry and shoot fresh weights, plant height, and leaf chlorophyll content, as well as the percentage of root contamination were measured. Based on the results, root dry and shoot fresh weight, plant height, and leaf chlorophyll content were significantly maximized following the treatments containing urea and triple superphosphate at various levels, and endophytic fungus (p<0.05). In terms of pathogenesis control, about 46% decrease was observed in take-all disease for the treatment receiving urea+triple superphosphate alone. The disease was respectively controlled by around 58 and 75% after applying endophytic fungus M. bolleyi alone and in combination with the highest amount of urea+triple superphosphate, respectively.

We aimed to explore the entomopathogenic fungi (EPF) from the different ecosystems including forests, gardens, fields, and rangeland soils in Kermanshah province, Iran. Trials were carried out on morphological, molecular characterization, diversity indices, and virulence assessments of indigenous EPF from 41 sampling sites of various localities. Using the Ephestia kuehniella (Zeller) as host bait, 114 fungal isolates were recovered-i.e., 39 from forests, 38 from fields, 22 from rangelands, and 15 from garden soils. Based on morphological features and the sequence analysis of the internal transcribed spacer (ITS) of the ribosomal DNA, the recovered entomopathogenic fungi were identified as Alternaria chlamydosporigena, Aspergillus nomius, Beauveria bassiana, B. pseudobassiana, B. brongniartii, Chaetomium elatum, Fusarium equiseti, F. oxysporum, Fusarium sp., Meyerozyma guilliermondii, Paramyrothecium roridum, Penicillium sizovae, P. solitum and Penicillium sp.. Higher species richness was found in the oak forest soils compared with fields, gardens, and rangelands. Additionally, the oak forest soils had high values of diversity indices, i.e., Simpson Ds (0.97), Shannon (3.30), Equitability (0.69), and Fisher's alpha (25.8). The dominance index was higher in the rangelands compared with the others. Following the priliminary assays, the insecticidal activity of three selected EPF isolates, including Beauveria brongniartii, B. bassiana, and B. pseudobassiana was tested against adults of the cowpea beetle, Callosobruchus maculatus (F.) (Coleoptera: Chrysomelidae: Bruchinae) as host. Hypervirulent strains caused high mortality considered as promising effective biocontrol agents in insect pest management programs.

Travertine stone (Abbas Abad type) is one of the widely used stones in Iran. The mines of this stone, one of the most luxurious travertine stones in the world with a white-background color, are located in Mahalat, although its production is mainly carried out in Isfahan province. In our visits of various building stone sites in Hafiz town, Shiraz, Fars province in 2021, loose and rotten stones with black streaks were observed from which the rocks are cracked, causing a severe damage to stonework’s industry (Fig. 1a). To isolate fungi, small pieces (5 × 5 mm) of stone samples were surface disinfested with 0.5% sodium hypochlorite for 1 min, washed three times with sterilized distillate water and plated on potato dextrose agar (PDA; Merck, Darmstadt, Germany). Purification of isolates was done by hyphal tip technique. Among the isolated fungi, one isolate that was recovered from Imperator work stone in Hafiz town, Shiraz (Fars province) was identified as Ascotricha funiculosa (Guarro & Calvo) D.W. Li & G.H. Zhao, based on morphological features (Guarro and Calvo 1983) and sequences data. Macroscopic and microscopic features of the fungus are given here.Colonies were slow-growing, attaining a diameter of 17 mm in seven days on PDA (Merck, Darmstadt, Germany), first dull white, then becoming grayish with a white edge (Fig. 1b). The colony on the reverse side of the agar plate was blackish (Fig. 1c). Conidiophores were borne mostly as short vertical branches from individual hyphae, commonly 70-130 × 2.5–4.5 μm, composed of a differentiated supporting hyphae bearing sterile swollen cells hyaline and groups of conidiogenous cells. Stipe was smooth, simple or once branched, septate, hyaline when young, becoming olive-brown at maturity, swollen cells hyalin, sterile, thin-walled, 6-8 × 4-5 μm, rounded above (Fig. 1d-h). Conidiogenous cells were lateral and terminal, sympodial, developing conidia on denticles (Fig. 1g-h). Conidia were smooth, subglobose to ellipsoidal, unicellular, hyaline when young, becoming light brown at maturity, with a minute scar at the base, and 4–6 × 3.5–4.5 μm (x̄ = 5 × 3.5 μm, n = 100) (Fig. 1i).For confirmation of morphological identification, DNA of representative isolate was extracted using a commercial kit (Zagros Bioidea Co., Razi University Incubator, Kermanshah, Iran). PCR was performed using primers ITS1 (CCGTAGGTGAACCTGCGC) and ITS4 (TCCTCCGCTTATTGATATGC) for the internal transcribed spacer region (ITS1-5.8S-ITS2) of the nuclear ribosomal DNA (rDNA) (White et al. 1990), and Bt2a (GGTAACCAAATCGGTGCTGC TTTC) and Bt2b (ACCCTCAGTGTAGTGACCC TTGGC) for a part of the β-tubulin gene (Glass & Donaldson 1995). The PCR product was submitted for sequencing to a capillary sequencing machine (Pishgam Biotech Co., Tehran, Iran). The sequence generated in this study was deposited in GenBank under accession number OK324153 (ITS) and OK337389 (β-tubulin gene).BLAST analysis revealed a high nucleotide identity (99% for ITS and 98.7% for β-tubulin gene) with the ITS region and β-tubulin gene of Ascotricha funiculosa isolate CBS 323.86 (KU684134 and KU683762) that was recently reported from North American (Cheng et al. 2015). Two datasets, including individual aligned sequences of ITS, and the combined ITS and β-tubulin datasets (ITS- β-tubulin), were used to phylogenetic analysis of Ascotricha. Phylogenetic analyses were performed using maximum likelihood (ML) method in the MEGA Ver. X program (Kumar et al. 2018). Phylogenetic analyses based on ITS (Fig. 2), and combined ITS and β-tubulin gene sequences (Fig. 3) of our isolates and 22 selected isolates of Ascotricha (Table 1) showed that our isolates are closely related to A. funiculosa (Figs. 3, 4). The isolates formed a well-supported clade with the reliable reference strains of A. funiculosa (Figs. 2, 3), placed separately from the other species of Ascotricha. The result of the phylogenetic analysis was in accordance with the molecular identification based on DNA sequences in BLAST search, thus resolving the morphological identification.In Iran, Ascotricha chartarum has been reported from Abbas abad travertine stone (Jamali 2021). Information about of A. funiculosa is rare and this species previously has been reported from Spain. A. funiculosa differs from other species in the morphology of its conidiogenous cells (Guarro & Calvo 1983) and in lacking a sexual stage. In this study also, sexual stage was not seen in culture media. Ascotricha funiculosa is new to the Iranian funga, and is reported for the first time from building stone in the world. A subculture of this fungus is preserved at the Iranian Fungal Culture Collection of the Iranian Research Institute of Plant Protection (Tehran, Iran) under accession number IRAN 4558C. The genus Ascotricha (Ascomycetes, Xylariaceae) was erected by Berkeley in 1838 to accommodate the single species A. chartarum (Hawksworth 1971). So far, 29, and 30 Ascotricha species are recorded in the MycoBank and Index Fungorum, respectively.Many researchers have reported Ascotricha species in the China, Germany, India, Italy, New Zealand, North America, Portugal, and Spain, (Stchigel & Guarro 1998; Udagawa & Uchiyama 1999; Li & Yang 2004; U’Ren et al. 2016; Vu et al. 2019) but no such studies have been carried out in Iran.

Truffles are edible fungi belonging to the phylum Ascomycota. These valuable fungi can be divided into two categories: desert and forest truffles. They are obligatory mycorrhiza forming with some trees, shrubs, annual and perennial plants. These fungi belong to 38 genera of six families of the order Pezizales, class Pezizomycetes. The forest truffles are classified in the Tuberaceae family and the desert truffles in the other families. The existence of Tuber aestivum from the family Tuberaceae, Terfezia claveryi, Terfezia boudieri, Tirmania pinoyi, and Tirmania nivea from the family Pezizaceae, Picoa juniperi, Picoa lefebvrei, Geopora cooperi and Geopora cooperi, from the family Pyronemataceae, has been morphologically and molecularly proven by researches in Iran. The morphological characteristics, symbiotic plants, and distribution areas of these fungi are described here.

Thermophilic fungi produce a variety of enzymes that in addition to biocatalytic activity, are widely used in biological processes in many industries, including food, paper, detergents, pharmaceuticals, toxic waste removal, and oil drilling. Extraction of enzymes, especially amylase, from thermophilic fungi has greatly contributed to industry and the global economy, so that one of the indicators of economic prosperity in developed countries. The aim of this study was to isolate and identify thermophilic fungi from soil, municipal waste compost and mushroom compost and to investigate the ability of amylase production of isolates. Isolation was performed by serial dilution method on potato-dextrose-agar extract at 45 and 50 °C. Molecular identification of isolates was performed by amplification of the ITS rDNA region (ITS1–5.8S – ITS2) using the general primers ITS1 and ITS4 during the polymerase chain reaction. The amylase activity of the isolates was studied in agar-bearing culture medium containing starch. Due to the bright halo created around the colonies after 48 hours at 37 °C, most of the isolates were able to decompose and enzymatic activity. The highest bright halo and amylase activity belong to a species of Thermomyces sp. and followed by Malbranchea cinnamomea, Thermomyces dopuntii, Thermomyces lanuginosus, Absidia sp., Aspergillus nidulance, Aspergillus fumigatus, Aspergillus niger, and Aspergillus terreus had the highest amylase activity, respectively. Thielavia arenaria and Melanocarpus albomyces showed no activity of producing amylase. This is the first comprehensive study on thermophilic fungi with ability of producing amylase in Iran. All isolates of the present study were deposited to the Iranian Plant Protection Research Institute.

Different techniques are used nowadays to assess genetic diversity in insects. Due to the importance of studying the genetic diversity and populationchr(chr('39')39chr('39'))s genetic structure in the conservation of species, the genetic diversity of Iranian honey bees collected from 20 provinces of Iran was investigated using PCR-RFLP markers. The 300 samples of young honey bee workers were collected from different parts of the country, and their DNA was extracted from the head and thorax according to the salting-out method with minor modifications. In this study, PCR-RFLP analyses of mitochondrial DNA regions (COI and 16S rDNA genes) were used, and each of these genes was digested by four restriction enzymes. The results showed very low genetic diversity in the studied honey bee populations. The observed and expected heterozygosity, Shannon index and the number of observed and effective alleles were calculated and found to be zero in most of the populations. The results of cluster analysis showed that the studied honey bee samples were scattered and integrated throughout the branches, none of them formed a separate population, and all of them formed a single group which can be due to the nature of the PCR-RFLP markers, low enzymatic polymorphism, haplodiploidy reproductive system of the honey bee, human activities, queen and hive trade among beekeepers, winter-summer displacements and migration to similar areas. Therefore, according to the results of the present study and its inconsistency with previous research, using PCR-RFLP marker is not recommended for future attempts to investigate the genetic diversity of honey bee populations.

Abbas Abad travertine stone is one of the widely used travertine stones in Iran. The mines of this stone are located in Mahallat (Markazi province). By visitings various building stone sites of Shiraz (Fars province) in 2021, loose and rotten stones with black streaks were observed from which rocks were cracked (Fig. 1). Among the isolated fungi, one isolate was identified as Ascotricha chartarum Berk. based on morphological features and sequences data. Colonies slow-growing, having a diameter of 10 and 8 mm in seven days on PDA and MEA (Merck, Darmstadt, Germany), respectively; first dull white, then becoming black with an orange edge. Perithecia dark brown to black, globose or subglobose, 95–210 × 70–100 μm, ostiolate, with distinct, short cylindrical neck, 5–6.5 µm diam. Ascomatal hairs erect, rigid, dichotomously branched, geniculate, dark brown to black, septate, 3.9–5.5 µm at the base, with thin-walled vesicles at geniculate nodes. Asci cylindrical, thin-walled, evanescent, 8-spored, and 65–70 × 8–11 μm; Ascospores uniseriate, dark olive-brown to black when mature, ellipsoidal, smooth, discoid with a distinct equatorial slit, 6.5–9.2 × 6–8.2. Conidiophores in asexual morph (Dicyma ampullifera Boul.) straight, stiff, smooth or slightly roughened, simple or dichotomously branched, septate, brown to black below, becoming pale brown or hyaline above, up to 2 mm long, 3.5–5.5 μm diam., with pale, thin-walled vesicles at the bends, resembling the ascomatal hairs. Conidiogenous cells lateral and terminal, cylindrical, sympodial, developing conidia on denticles. Conidia lightly rough, irregularly globose to ellipsoidal, hyaline when young, becoming light brown at maturity, 4.7–6.4 × 2.2–3.8 μm. The sequence generated in this study was deposited in GenBank under accession No.: MW916314. BLAST analysis revealed a high nucleotide identity (99%) with the ITS region of A. chartarum (LS450963 and KF893284) which was recently reported from Kuwait and China, respectively. Ascotricha chartarum is new to the Iranian mycobiota, and is reported for the first time from building stones in the world.

Green Lacewing as one of the most important groups of insects with characteristics such as the possibility of mass production, geographical distribution and host range have been considered in biological control. The study about genetic diversity is one of the effective tools in genetic conservation of important species. Today, the production of barcode sequences for species identification is expanding. Mitochondrial genes are important tools for various studies in the fields of population genetics, evolution and phylogenetics. This study investigated the genetic diversity of populations of this species from seven provinces of Iran, using part of the mitochondrial DNA gene, cytochrome oxidase COI. Gene sequences of the samples were compared using MEGA5 and Bioedit7 softwares. The obtained sequences were analyzed with 517 bp for mitochondrial cytochrome oxidase I (COI) gene. Genetic parameters related to 9 haplotypes in these populations were examined. Haplotypic diversity, number of nucleotide differences and nucleotide diversity in all populations were calculated as 0.91429, 1.93333, 0.00374, respectively. The highest nucleotide diversity was observed for Gilan and Kermanshah provinces, the highest number of nucleotide differences was observed in the population of East Azarbaijan province and the highest haplotypic diversity was observed in the population of Kermanshah, Gilan and East Azarbaijan provinces. The results of geographical grouping showed that the southern regions of the country have less haplotypic diversity than other regions.

The Pezizales are an order of the subphylum Pezizomycotina within the phylum Ascomycota. Members of this order are characterized by unitunicate asci that typically open by rupturing to form a terminal or eccentric lid or operculum (Hansen & Pfister 2006). Of the 1638 Pezizales species known so far, Geopora Harkn. (Pyronemataceae) is represented by 23 species (Kirk et al. 2008). Geopora spp. are characterized by entirely or partially hypogeous, globular, semi-globular or cup-shaped ascocarps, whitish, greyish or yellowish grey hymenium, cylindrical, 8-spored and operculate asci, generally bifurcate, septate and hyaline paraphyses, ellipsoid, smooth ascospores mostly with one or two larger oil drops and some smaller oil drops (Tamm et al. 2010, Perić & Perić 2011). The members of the Geopora spp. are widely distributed in the Northern Hemisphere. Many researchers have reported Geopora species in North America, central, north, south and southeast Europe, and the Middle East (Tamm et al. 2010, Ashraf & Khalid 2012, Guo et al. 2019, Saba et al. 2019, Uzun & Kaya 2019). Saber & Pegler reportedthe presence of G. arenicola (Lév.) Kers in Iran as Sepultaria arenicola (Ershad 2009). In this study, two specimens of G. cooperi associated with Pinus nigra were collected in Khorassan Razavi province (Iran) in 2020 (Fig. 1a) with the following characteristics: Ascomata 50–55 mm in diameter, globose, subglobose to oblong, irregularly convoluted, peridium dark brown and covered with light brown hairs, gleba white to pinkish-white, highly convoluted, convolutions close but separate (Fig. 1b, c). Hymenium 200–250 μm thick. Asci 180–270(215) × 15–22(16) μm, cylindrical, 8-spored, non-amyloid and tapering at the base (Fig. 1d, e). Paraphyses cylindrical, septate, swollen at the tips, nearly of the same level as ascus, enlarged at the apex up to 11.5 μm (Fig. 1f). Ascospores 18–27(23) × 13–17(14) μm, smooth, hyaline, broadly elliptical, thin-walled, generally with a large central guttule (Fig. 1g, h). Ectal excipulum 120 μm, 4–5 cells thick, dark brown, textura globulosa,cells oblong to circular in section, smooth, walls thick and dark brown, 24–40 × 18–27 μm, cells on the outside darker than the inner cells (Fig. 1i). Excipular hairs hyphae-like, branched, very long to 1000 μm, 5–17 μm wide, blunt at the tips and dark walls (Fig. 1j). All these characteristics were consistent with other authors’ descriptions for G. cooperi (Tamm et al. 2010, Guo et al. 2019).While Geopora cooperi isconsidered as a very rare species by Perić & Perić (2011), itwas widely reported from Europe (Austria, Sweden, Norway, Denmark, Switzerland, Spain, and Italy) by Nannfeldt (1946), Moser (1963), Burdsall (1968), Soleilhac (1972), Ortega et al. (1981), Moreno et al. (1991), and Montecchi & Dal Forno (1995). This species is hereby reported new to the mycobiota of Iran. The mycorrhizal association of Geopora species with various conifers and deciduous trees such as Pinus ponderosa Lawson & Lawson (Fujimura et al. 2005), Pinus edulis Engelm., Cercocarpus ledifolius Nutt., Salix linearistipularis (Franch.) K. S. Hao, Quercus garryana Douglas ex Hook. (Frank et al. 2009), Quercus douglasii Hook., and Arn. (Smith et al. 2006), Picea abies (L.) Karst.(Tedersoo et al. 2006), Epipactis atrorubens (Hoffm.) Besser. (Shefferson et al. 2008), Abies grandis (Dougl.) Lindl., Cedrus spp., and Populus spp. (Tamm et al. 2010) have been confirmed by molecular techniques. Fujimura et al. (2005) have reported G. cooperi form mycorrhiza with Pinus ponderosa. Tedersoo et al. (2006) have identified ectomycorrhizal Geopora spp. on root tips both in coniferous and deciduous woodlands. They also have found Geopora spp. occurred in various early- and late-successional woodlands in acidic to alkaline forest soils, in addition to cinder and burnt soils. Association of G. cooperi with P. nigra, has been previously reported by Burdsall (1968) from the USA. Specimen examined: Iran: Khorassan Razavi province, under Pinus nigra, solitary, on ground, 24 July 2020 (IRAN 16696F).

An investigation was carried out on the occurrence of thermotolerantand thermophilic fungi in 11 soil samples collected from cultivated and natural regions in Kermanshah province (Mahidasht, Harsin, Kerend, Eslamabad-e Gharb, Qasr-e Shirin, Sarpol-e Zahab, Javanrood, Gilan-e Gharb), municipal waste compost and mushroom compost, 2017–19. Fungal isolates were recovered using the soil dilution plate method on potato dextrose agar at 45 and 50 °C. Totally, 24 isolates were obtained that were primarily identified using morphological characters and referring to valid taxonomic keys. DNA extraction was carried out using a Genomic DNA Purification kit. The ITS region (ITS1-5.8S-ITS2) of the ribosomal DNA was amplified using ITS1 and ITS4 primers. Fragments about 500–700 bp were amplified after sequencing deposited in GenBank. Based on morphological characters and sequence data of the ITS rDNA, these fungi were identified as: Aspergillus fumigatus, A. nidulans, A. niger, A. terrus, Melanocarpus albomyces*, Malbranchea cinnamomea*, Thermomyces dupontii*, Th. lanuginosus*, and Thielavia arenaria*. Asterisks indicate species that are new records for the mycobiota of Iran. The abundance of thermophilic fungi in municipal waste compost was higher than soil, and Aspergillus species were the most abundant fungi identified in this study.

An investigation was carried out on the occurrence and distribution of entomopathogenic fungi in 41 soil samples collected from cultivated and natural regions in Kermanshah province (West of Iran) from July 2017 to April 2018. Among 41 soil samples, 114 fungal isolates were recovered with 39 from forests, 38 from fields, 22 from rangelands and 15 from garden soil. Based on the morphological characters and phylogeny of DNA sequence data for the internal transcribed spacer (ITS) rDNA and comparing the sequences with that available in NCBI database, the entomopathogenic fungi recovered were identified as: Aspergillus nomius*, Fusarium oxysporum, F. equiseti, Fusarium sp., Penicillim solitum, P. sizovae*, Penicillium sp., Alternaria chlamydosporigena, Meyerozyma guilliermondii, Paramyrothecium roridum, Chaetomium elatum, Beauveria bassiana*, B. pseudobassiana, and B. tenella*. The asterisk species are the new records for the mycobiota of Iran.

Morphological and molecular studies are considered as a powerful tool for estimating genetic diversity and the determination of phylogenetic relationships among different populations of honeybee subspecies. In the present study, morphological and molecular markers (PCR-RFLP) were used to study the phylogenetic relationships of Iranian subspecies honeybee with other honeybee subspecies around the world. Samples were collected from 100 cities belonging to 20 Iranian provinces during the summer of 2016. A total of 2,250 and 300 worker bees were studied for morphological and molecular analyses, respectively. The results of phylogenetic trees plotted using morphological and molecular markers revealed that 29 honeybee subspecies were classified into five groups. In this clustering, the Iranian subspecies honeybee (A. m. meda) with A. m. cyprica, A. m. syriaca, A. m. anatolica, A. m. armeniaca, A. m. caucasica, A. m. caucasica, Am. Pomonella subspecies were assigned in same cluster. This group included subspecies from Eastern Mediterranean, the Near East and the East of the Middle East (O), which was reported in previous studies. The results showed that the honeybee subspecies (or race) in Iran was exactly the same as the Iranian honeybee subspecies (A. m. meda); it also seems that imports of foreign subspecies in the past two decades and the trafficking imports of queen in the last decade had no significant impact on Iranian honeybee subspecies genetic purity due to its adaptation to the country's climates and the instability and incompatibility of other imported subspecies, so that it has not lost its genetic identity.

Through a survey of macrofungi in Ghalajeh heights and its surrounding plains, conducted from 2014- 2017, twelve specimens of macroascomycota were collected. The specimens were identified on the basis of macro- and micro-morphological characteristics. The internal transcribed spacer sequences of the selected specimens were analyzed to confirm the morphological identification. Based on the results, five species, including Terfezia claveryi, Tirmania pinoyi, Helvella acetabulum, Picoa juniperi and Picoa lefebvrei were identified. T. claveryi and T.pinoyi species had been previously reported from Kermanshah Province, but H. acetabulum, P. juniperi and P. lefebvrei species were reported for the first time.

Agaric fungi are a large group of Basidiomycetes that known as mushrooms in the broad sense. In order to identify and characterize the agaric fungi in oak forests of Kermanshah province, specimens were collected in 2014-2015. Microscopic and macroscopic characteristics including size and color of cap and stem, size and shape of basidia, the number of strigma, size, shape and color of spores and cystidia type were checked. Both morphological and ITS sequencing were used for identification. DNA extraction was carried out using a Genomic DNA Purification kit. The ITS1, 5.8S, and ITS2 (ITS) Regions were amplified using ITS1 and ITS4 primers. Fragments about 600 bp were amplified and after sequencing deposited in GenBank. Based on both morphological and molecular characteristics Agrocybe praecox (KT833856), Cyclocybe cylindracea (KT833863), Coprinopsis atramentaria (KT833863), Entoloma serrulatum (KT833862), Hebeloma alpinum (KT833861), Hypholoma fasciculare (KT833860), Lactarius glaucescens (KT833859), Lepiota cristata (KT833859), Pholiota gummosa (KT833858), Psilocybe atrobrunnea (KT833864), Psilocybe cyanescens (KT833857), Stropharia aeruginosa (KT833865). Boletus erythropus and Irpex lacteus were identified in Kermanshah province. Hebeloma alpinum, Entoloma serrulatum and Cyclocybe cylindracea are new for Iran mycoflora. All representatives were deposited in fungal collection of Plant Protection Department, Razi University, Kermanshah, Iran.

Neocosmospora E.F. Smith is a filamentous ascomycete fungal genus belong to Hypocreales order and contains several species mainly pathogenic for plants (Cannon & Hawksworth 1982). Species of Neocosmospora are known to live in the soil of tropical or subtropical areas and often in association with plant roots. During summer 2017, for isolation of Fusarium species from uncultivated soil (foothill) in Qasr-e Shirin (Kermanshah province, Iran), we recovered one isolate of Neocosmospora. Soil samples were collected from 0–20 cm depth. The isolates were recovered using a soil dilution plate method directly from uncultivated soil. Isolation was performed from soil using komada and potato dextrose agar. Genomic DNA was extracted using CTAB method (Garde et al. 1991). The internal transcribed spacers (ITS) of nuclear ribosomal DNA and apart of the Ef1-α translation elongation factor (TEF1) gene were amplified by PCR using the primer pair ITS1 (5-TCCGTAGGT-GAACCTGCGG-3)/ITS4
(5-TCCTCCGCTTATTGATATGC-3) (White et al. 1990) and EF1F (5-ATGGGTAAGGAGGACAAGACTC-3)/EF1R
(5-TGGAGATACCAGCCTCGAAC-3) (O’Donnell et al. 2008) in a final volume of 25 μM reaction containing 20 ng genomic DNA, 1 μM of each primer, 100 μM of each dNTP, 0.5 U Taq DNA polymerase (CinnaGen, Iran), 1.5 mM of MgCl2, 2.5 μM of 10 × PCR buffer (CinnaGen, Iran), and 14.5 μM H2O. Amplifications were conducted in a T-Personal thermocycler (Biometra, Germany) for 30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for 60 s, with initial denaturation of 3 min at 94 °C before cycling and a final extension of 10 min at 72 °C after cycling. A portion (5 μM) of the amplified product was run on 1% TBE-agarose gel and the presence of a single band (ca. 540 bp) was a check for successful amplification. Phylogenetic analyses were conducted with maximum likelihood (ML) in the Molecular Evolutionary Genetic Analysis (MEGA) Ver. 5 program (Tamura et al. 2011). The best fit nucleotide substitution model (Jukes-Cantor) was based on the bayesian information criterion and was implemented in MEGA 5. Sequence produced in this study is deposited in GenBank under accession numbers MG811579 (ITS region), and MH976665 (Ef1-α). Mycelium white to creamish (Fig. 1A). Perithecia orange to pinkish red, globose to subpyriform with small neck, ostiolate, 240–350 µm tall and periphyses present (Fig. 1B). Asci cylindrical,
8-spored, thin-walled, not amyloid, with truncated apex with a short pedicel, and 80–100 × 10–12 μm (Fig. 1C). Ascospores were uniseriate, rugose ornamentation, globose to ellipsoidal, hyaline when immature and brown at maturity, sometimes with oil droplets, and 11.23(10–12.58) × 9.63(8.03–10.45) µm (Fig. 1D). The fungal isolate was identified as N. vasinfecta using morphological characteristics and sequence analysis of ITS region and apart of the Ef1-α translation elongation factor. Based on a BLASTn search of NCBI GenBank nucleotide database, the closest sequence to our fungus (GenBank Accession Nos: MG811579 for ITS, and MH976665 for Ef1-α translation elongation factor) was N. vasinfecta isolated from soil from India (GenBank KM231804; identities = 99%) and France (GenBank JX997934; identities = 100%). The phylogenetic analysis of the sequenced ITS fragment positioned the our isolate within the N. vasinfecta clade (94 %) (Fig. 2). Neocosmospora vasinfecta has been reported from soil in South Africa and India (Lombard et al. 2015), clinical materials in France and Senegal (Ben Hamida et al. 1993, Dromer et al. 1997, Kac et al. 1999, Gabriel et al. 2013), and animal dungs (Doveri 2011). This species have been also reported as phytopathogenic fungus from peanuts in Vietnam, Australia, South Africa and Taiwan (Dau et al. 2010, Fuhlbohm et al. 2007, Huang et al. 1992, Baard & van Wyk 1985), Arachis hypogaea plant in Guinea (Lombard et al. 2015), and other plants (Manikandan et al. 2011). A culture of the fungus is deposited at the Iranian Fungal Culture Collection, Iranian Research Institute of Plant Protection, Tehran, Iran. To our knowledge, this is the first report of N. vasinfecta from Iran.
Specimen examined: Iran: Kermanshah province, Qasr-e Shirin, 45° 95΄ E, 33° 96΄ N, 26.06.2017, from uncultivated soil, Sh. Saeedi (IRAN 3320 C).

The Mediterranean pine engraver, Orthotomicus erosus (Wollaston) (Coleoptera: Curculionidae: Scolytinae), is one of the most important pests of pine trees in Kermanshah. Attack and feeding of this pest destroy the floem tissues under the bark of the infected trees and disrupt the plant sap flow, causing the death of infected trees. The purpose of this study was to predict and mapping the distribution of O. erosus using multi-layer perceptron neural networks combined with genetic and imperialist competitive algorithms in Kermanshah. The sampling of pine trees was done in 2015-2016 in Kermanshah. To evaluate the ability of the used neural networks to predict the distribution was used statistical comparison the parameters such as mean, variance and statistical distribution between actual and predicted values by multi-layer perceptron neural networks combined with genetic and imperialist competitive algorithms. Results showed that in training and test phases, was no significant differences between average, variance and statistical distribution of actual and predicted data that indicates the high accuracy and the ability of neural networks to map the distribution of this pest in Kermanshah. The R2 values revealed that imperialist competitive algorithm had a higher accuracy to estimate the density of O. erosus compared with the other two methods. In addition, the comparison of the coefficients of the R2 between different neural networks and geostatistics method showed that all three neural network models predicted the distribution pattern of O. erosus better than the geostatistics method. The maps drawn by all three neural networks showed that the distribution of this pest was cumulative. The results obtained from the geostatistics method represented the cumulative distribution of the pest.

The gray mold disease caused by Botrytis cinerea is one of the important post-harvest diseases especially in apple and Strawberry. In order to biological control of B. cinerea, we used 14 isolates of ascomycetous yeasts obtained from natural resources and plants. For molecular identification of yeast isolates, genomic DNA extracted and D1/D2 domain of the large subunit (LSU) rDNA gene sequenced. Nine species including Pichia kudriavzevii, Pichia galeiformis, Galactomyces candidum, Meyerozma guilliermondii, Saccharomyces cerevisiae, Zygoascus meyerae, Pichia sp., Candida parapsilosis, Metschnikowia sp., Candida boidinii, Lecythophora sp. and Candida catenulatea were identified based on sequence similarity of D1/D2 domain of the LSU rDNA gene of the isolates with those in NCBI database. The dual culture method used for assay of their biocontrol activity against of B.cinerea on potato dextrose agar medium in a completely randomize design with tree replications. Our results show that highest inhibitor effect related to G. candidum with 47.85 percent and lowest effect related to P. kudriavzevii with 6.53 percent. In this study, yeast isolates obtained from natural resource and plants showed high biocontrol activity against of B. cinerea.

In recent years, biological control has become a promising and ecologically friendly alternative to chemical control in the management of soil-borne plant diseases and several biological control agents have been introduced as potential bio-fungicides. The aim of this study was to investigate different biological control agent consortia against Rhizoctonia solani root rot disease of common bean. Bacillus pumilus INR7, Trichoderma harzianum and Rhizophagus intraradices were used individually or in combination. There were two application simultaneous application of biocontrol agents with the plant pathogen, and pre-inoculation of biocontrol agents one month before the pathogen. Treatments containing B.pumilus INR7 were the best treatments for suppression of the disease in the simultaneous application method, where B. pumilus INR7 T. harzianumreduced the disease up to 54%. However, in pre-inoculation method T. harzianum alone was the only treatment that reduced disease severity up to 49% compared to the infected control; other treatments did not haveany significant effect on disease severity. In current study, combination of T. harzianum and R. intraradices was unable to decrease disease severity and improve plant growth. This phenomenon was common in both simultaneous and pre-inoculation experiments. However, results showed that B. pumilus INR7 and R. intraradices were compatible with each other. Their combination not only decreased the disease, but also improved the dry weight of common bean in both application methods. Our results revealed that B. pumilus INR7 had positive interaction with T. harzianum. This combination increased their ability to suppress root rot disease and improve plant health, significantly. Overall, combinations of biocontrol agents have good potential to be applied in modern agriculture, but such combinations need to be checkedin advance for their compatibility in greenhouse and field experiments.

Rhizopogon is a hypogeous fungal genus that grows in an ectomycorrhizal symbiosis mostly with members of the Pinaceae family and its worldwide distribution correlates with natural and exotic Pinaceae forests. In Iran, Rhizopogon species have received scant attention from collectors in the past and have not been adequately collected. Few older studies, report the presence of R. luteolus (Saber 1999), and R. vulgaris in Iran (Ershad 2009). However, the accuracy of the species identification merely on the basis of morphological features is questionable. Rhizopogon roseolus is common in northwestern United States USA (Coker & Couch 1928, Harrison & Smith 1968). So far, it has been reported from, Finland (Schulmann 1955), Chile (Garrido 1986), Brazil (Baseia & Milanez 2002), Poland (Iwanski et al. 2006), Spain (Dominguez-Nunez et al. 2013) and New Zealand. In this study, seven specimens associated with roots of Pinus eldarica based on morphological and molecular characteristics were examined. Basidiocarps were hypogeous, globose, subglobose or irregular with different sizes (up to 10 cm in diam.) (Fig. 1A). Peridium was smooth and orange. Gleba was white to olive (Fig. 1B). Fresh mature basidiocarp not reacting in iodine. The basidia were club-shaped and 15–20 × 6–8 μm (Fig. 1C). Columella absent and paraphyses about 12–18 × 5–9 μm (Fig. 1D).
The basidiospores ellipsoidal, smooth, hyaline, 6–8 × 3–4 μm, often contain two guttulae inside and falsely septate (Fig. 1E). All DNA sequences of Rhizopogon (accession numbers: KP202698 to KP202700) showed 100% homology with valid sequences previously identified and deposited in GenBank. Phylogenetic trees constructed based on ITS sequences showed that, all Iranian specimens are in the same branch in a clade with R. roseolus reported from other authors (Fig. 2). Rhizopogon roseolus, R. Burlinghamii, and R. vulgaris form distinct clades which were well-supported by bootstrap value (78% MP). This is the first report of R. roseolus and its host plant from Iran.
Voucher specimens are deposited in the Culture Collection of the Ministry of Jihad-e-Agriculture (“IRAN”) located at the Iranian Research Institute of Plant Protection, Tehran, Iran (IRAN-16730F).

Background and Trichosporon is a genus of anamorphic basidiomycetous yeast which is widely distributed in nature and is found in tropical and temperate areas. The aim of this work was to study the isolation, identification and molecular analysis of Trichosporon species in soil.
In order to isolate and identify Trichosporon species in soil, 30 samples were collected from 30 different locations across Iran. The isolates were identified by means of the standard methods of yeast identification. To confirm morphological identification, genomic DNA was extracted and the hypervariable D1/D2 domain of the large-subunit (LSU) ribosomal DNA (rDNA) gene was amplified by polymerase chain reaction (PCR), using primer pair NL-1/NL-4, and then the sequences were analyzed.
According to the morphological and physiological assessments, isolates were identified as T. coremiiforme. The isolates formed chlamydospore after one week on yeast-malt (YM) agar medium. Using Blast program, we found that the D1/D2 sequences of the T. coremiiforme isolates from Iran (accession no: KP055040 and KP055041) showed 99% homology with the T. coremiiforme deposited in GenBank. All the T. coremiiforme isolates placed in the Ovoides cluster were well-supported by bootstrap values.
The present study is the first attempt to survey Trichosporon in soil of Iran. To the best of our knowledge, this is the first investigation of T. coremiiforme in Iran.

Picoa species are hypogeous desert truffles, which can be found in semi-arid ranges of North Africa, West Asian, South of Europe and Middle East, including Iran (Moreno et al. 2000, Jamali & Banihashemi 2012, 2013). Picoa species form symbiosis mainly on roots of annual and perennial herbaceous plants of the Helianthemum, including H. ledifolium and H. salicifolium var. salicifolium (Jamali & Banihashemi 2012, 2013), H. nummularium (Riousset et al. 1989, 1996), H. sessiliflorum (Sbissi et al. 2010), H. squamatum and H. kahiricum (Moreno et al. 2000). In Iran, mycorrhizal association between sedge and desert truffles is little known. Ammarellou et al. (2007) isolated the sedge roots (Kobresia bellardii) directly from under zone of Terfezia boudieri. During 2013–14, roots of Carex stenophylla Wahlenb were collected from various rangeland sites in Iran. The field and anatomical studies showed that, C. stenophylla have ectomycorrhizal associations with P. lefebvrei in the studied areas. In general, external mycelium was observed around all the mycorrhizal plants. The ITS1-5.8S-ITS2 gene region was amplified with the genomic DNA extracted from roots by nested polymerase chain reaction using the universal fungal primer pair ITS1/ITS4 and specific primer pair FLE (5´GTA CCT TAC CTG TTG CTT CCG TG) and RLE (5´ATC CCT ACC TGA GCC GAG GTC AA) which were designed based on ITS1-5.8S-ITS2 gene region of Picoa lefebvrei. Nested PCR of ITS1/ITS4 amplified product with FLE/RLE primers resulted in amplification of 500 bp products in C. stenophylla roots. Sequences of PCR products amplified by FLE/RLE in two randomly root samples were similar (100%) with previously published DNA sequences of P. lefebvrei specimens and confirmed the existence of P. lefebvrei in mycorrhizal roots of C. stenophylla in the rangelands of Iran. Moreover, nested PCR increased the sensitivity of FLE/RLE primers to 10 fg DNA concentration.