جستجوی مقالات مرتبط با کلیدواژه « Imidacloprid » در نشریات گروه « کشاورزی »

Inheritance of resistance of the greenhouse whitefly, Trialeurodes vaporariorum Westwood (Hemiptera: Aleyrodidae), to imidacloprid and chlorpyrifos was studied. In this study, the Filistan population (FL) and the Fardis population (FR) were used as resistant and susceptible parents, which collected from Varamin and Karaj cities, respectively. The resistance ratios (RR) of FL population obtained for imidacloprid and chlorpyrifos were about 13.62 and 14.91-fold, respectively. LC50 values of chlorpyrifos on F1 (R♂×S♀) and Fʹ1 (R♀×S♂) crosses did not show any significant difference. Therefore, the resistance of T. vaporariorum to chlorpyrifos is autosomal. Also, the values of dominance factor indicated that the resistance of greenhouse whitefly to chlorpyrifos is inherited in incomplete recessive form. In addition, by using the expected mortality of the F2 generation with the generations resulting from crossing, it was determined that the resistance of T. vaporariorum to chlorpyrifos is polygenic. The results obtained from imidacloprid bioassays showed that the resistance of the greenhouse whitefly to this compound is autosomal, incompletely dominant, and polygenic. The present study suggests that according to the knowledge of the inheritance of resistance of T. vaporariorum, it is possible to delay the spread of resistance by using timely, correct, intermittent, and mixed insecticides.

Cucumber, Cucumis sativus L. is one the most important economic vegetables crop cultivated in Iran and many countries of the world. The cotton-melon aphid, Aphis gossypii Glover (Hemiptera: Aphididae), is one of the most destructive polyphagous pests of Cucurbitaceae plants in greenhouses and open fields. A. gossypii can cause severe damage in commercial fields. The honeydew that aphid excretes decreases the photosynthetic activity of plants and contaminates fruit, resulting in severely reduced quality. Moreover, A. gossypii can transmit more than 80 type of viral diseases that can cause substantially greater losses than the damage from direct feeding of the insect. The focus of the control methods against this pest in our country is the use of insecticides. Additionally, A. gossypii has developed different levels of resistance to many insecticides. Agricultural adjuvants can improve the efficacy of pesticides and can be effective in reduction of pesticides use. In the current research, the effects of two adjuvants (Scorch and Torpedo п) on efficiency of imidacloprid (SC35%) and flonicamid (WG50%) to control this aphid were investigated on cucumber in greenhouse. These two insecticides have systemic property doing their job after leaf penetration. It is known that the leaf penetration step is very determinative for systemic pesticides. Besides, Scorch and Torpedo п are multi-functional adjuvant, showing penetration, wetting, adhesion and spreading properties.

The project was performed based on a completely randomized design with 15 treatments and 3 replicates. The efficacy in the sampling units was recorded at 1, 3, 7 and 14 days after treatment. The treatments were: 1) imidacloprid (recommended dose); 2) imidacloprid+Scorch; 3) imidacloprid+Torpedo п; 4) imidacloprid (10% reduction of dosage)+Scorch; 5) imidacloprid (20% reduction of dosage)+Scorch; 6) imidacloprid (10% reduction of dosage)+Torpedo п; 7) imidacloprid (20% reduction of dosage)+Torpedo п. Flonicamid was replaced by imidacloprid in the treatments 8 to 14. The control treatment (No. 15) was sprayed by water only. The efficacy was calculated using the Henderson and Tilton formula. Statistical analysis was performed using the SAS software (ver. 9.1). One row was considered as the distance between the experimental units. Two rows on either side of the greenhouse were also considered as margins.

The combine analysis of variance showed that interaction of treatment × place was not significant, meaning that the experimental treatments had the same respond in different locations. Therefore, the data were statistically analyzed based on this, without considering the locations (Urmia and Karaj). The results showed that both adjuvants were able to improve the efficacy of imidacloprid and flonicamid, as it was confirmed at all times after spraying. For example, three days after spraying, the efficacy of imidacloprid alone was estimated at 81.47%, while "imidacloprid + Torpedo" and "imidacloprid + Scorch" were estimated at 92.60% at 93.43%, respectively. Similarly, seven days after spraying flonicamid alone showed 87% efficiency, whereas the treatment of "flonicamid+Torpedo" and "flonicamid+Scorch" exhibited 94.34% and 95.31%, respectively. When Torpedo п was used in combination of reduced doses of imidacloprid, the efficacy was severely reduced. Thus, the addition of Torpedo п is not recommended with reduced doses of imidacloprid. Instead, adding the Scorch when reducing the imidacloprid dosage, the efficacy was remained as high. For example, three days after spraying, "Imidacloprid with 10% dose reduction + Scorch" and "Imidacloprid with 20% dose reduction + Scorch" treatments were 93.65% and 94.23% efficacy, respectively. Besides, by reducing the flonicamid dosage and adding both adjuvant, the efficiency was as high as to the treatment using the recommended dosage. For example, 14 days after spraying, flonicamid with 10% dose reduction + Scorch and flonicamid with 20% dose reduction+ Scorch showed 93.94% and 93.48% efficacy, respectively. Our results can be important from both economic and environmental point of view, as the obtained results indicated that imidacloprid and flonicamid dosage can be reduced by 20%. However, it should be keep in mind that other factors, such as the price of adjuvants, are involved in their practical and field use by farmers, which should be taken into account.

Frequent and extensive use of various pesticides to control of common pistachio psylla (Agonoscenapistaciae), as one of the most important pests of pistachio, has provided the possibility of reduced susceptibility of this pest to pesticides. In this study, the susceptibility of 13 populations of A. pistaciae collected from pistachio orchards at areas of Bardaskan, Khalil Abad and Feiz Abad were studied to imidaclopridand to chlorpyrifos using bioassay experiments by leaf disc dipping method and based on the discriminating dose. The bioassay results indicated that the LC50 values of imidacloprid and chlorpyrifos on the susceptible population were determined as 261.2 and 83.03 ppm, respectively. The bioassay with discriminating dose (i.e. LC90 of the susceptible population) showed that all of the tested populations were susceptible to chlorpyrifos. But there were significant differences in susceptibility to imidacloprid between different populations compared to the susceptible one. The highest mortality percentage applying the discriminating dose was obtained for Kondor- susceptible population and the lowest one was related to Jalal-Abad, Zaher Abad and Kondor- resistant populations. The biochemical assays with measuring the esterase activity demonstrated that one of the mechanisms reduce susceptibility was an increase of esterase activity; so that, the activity of the susceptible population was 2.5 times less than that of populations that had low sensitivity. Furthermore, zymogram analysis showed that all populations had 2 enzyme bonds that qualitatively differ in the case of non-sensitive populations compared to the susceptible one. Measurement of glutathione S-transferase activity also showed that this enzyme system was involved in the reduction of the susceptibility of common pistachio psylla to imidacloprid.

Canola is an important oilseed crop in the world. Cabbage aphid, Brevicoryne brassicae is one of the most important pests of canola crop in Iran. In this study, the effect of chemical control of cabbage aphid was investigated in autumn and spring on Hyola 401 cultivar. For this purpose, spring and autumn sprayings with imidacloprid and pirimicarb at 1/1000 concentrations and insecticidal soap at 2.5% concentration were assessed using a randomized complete block design. The experiments were conducted during two growing seasons, 2011 and 2012 in Qazvin province. The results showed that, both autumn and spring spraying is necessary for pest control. Autumn and spring sprayings with imidacloprid caused 99.5 ± 0.4%, 94.5 ± 2.4% and 95.4.1 ± 1.0% mortality in 2011 and 99.1 ± 0.5, 86.9 ± 2.7 and 93.1 ± 5.5% mortality in 2012, three, seven and 15 days after treatment, respectively. Highest yield achieved at imidacloprid treatment and was 3533.00 kg/ ha. If not controlled, the damage would be 66.18, 69.35 and 78.0% at spring, autumn and spring-autumn treated plots.

Imidacloprid is an insecticide from the family of the neonicotinoids that is widely used to control agricultural pests. Furthermore, this insecticide can affect beneficial insects such as honey bee (Apis mellifera). Since learning and memory play an important role in honey bee behavior and social communication, the aim of this study was to investigate the learning and memory of honey bees treated with sublethal dose of imidacloprid using the proboscis extension reflex method under controlled laboratory conditions. In this experiment, honey bee extends its proboscis in response to antennal stimulation with sucrose. Data from this study showed that the oral treatment of honey bees with this insecticide did not affect water consumption, uncontaminated syrup and water responsiveness. But it reduced olfactory and visual learning and memory performances, and responsiveness to various sucrose concentrations. Therefore, our results show that the changes made by sublethal dose of imidacloprid have affected honey bee's responsiveness, which ultimately reduced colony health.

Background and Objectives:

 Water pH is one of the most important factors that affects the inefficiency of insecticides against the common pistachio psyllid, Agonoscena pistaciae Burckardt and Lauterer (Hemiptera: Aphalaridae), as the most important pest in Iran's pistachio orchards.

 Materials and Methods:

 In this study, the effect of insecticides including spirotetramat (Monvento® SC 10%) and imidacloprid (Confidor® SC 35%) and pH reducing agents, such as Rectiphier® and Citral pH®, on the reduction of population density of eggs and nymphs of common pistachio psyllid were investigated under field conditions. The experiment was carried out as randomized complete block design with four replications. The samplings were done one day before and 3, 7, 14, 21 and 28 days after spraying.

 Results:

 The results indicated that adding Rectiphier and Citral pH to the insecticides had no significant effect on increasing the efficacy of spirotetramat and imidacloprid on eggs population of pistachio psyllid, and only on 7 days after spraying, adding of Rectiphier to imidacloprid significantly increased the efficiency of the insecticide, and reduced the amount of oviposition of A. pistaciae (91.58%). The results of the effect of different treatments on nymphs population density of A. pistaciae showed that the effect of insecticides + pH reducing agents was more than application of insecticides alone, but their effect was not significant, and only on 3 and 7 days after spraying, Rectiphier significantly increased the effect of imidacloprid. The reduction of nymphal population densities in imidacloprid + Rectiphier treatment were 90.13% and 93.23%, on those sampling dates, respectively. 

Discussion:

PH reducers (Rectifier and Citral pH) could have the potential to increase the efficacy of spirotetramate and imidacloprid or other insecticides to control A. pistaciae and produce healthy crops, reduce costs, environmental hazards and side-effects on natural enemies and to minimize application of chemical insecticides. However, more research is needed with regard to the effect of different compounds of pH reducer, different concentrations of those compounds and also the effect of these compounds on different water pH. 

 The cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a significant agricultural pest in arable lands and on ornamental crops in temperate regions of the world and has been shown to be capable of developing resistance to many classes of insecticides. Difficulties in controlling B. tabaci mainly result from its resistance to insecticides, including neonicotinoids. Neonicotinoids are a relatively new class of synthetic insecticides used primarily to control of whiteflies, B. tabaci is capable of developing resistance to different classes of insecticides as neonicotinoides. It has been experimentally proven that resistance of B. tabaci to imidacloprid is associated with overexpression of the P450 genes. RNA interference (RNAi) has been successfully applied in insects to study RNAi mechanisms and gene functions. In this study, the RNA interference (RNAi) effects of P450 CYP6CM1 as key gene in resistance to neonicotinoides on expression, resistance ratio and total P450 activities were evaluated. Colony of whitefly reared on leaves of tomato plants in growth chamber at 25 ± 2 ºC, 65±5% RH and a photoperiod 16:8 h (light: darkness). Total RNA was isolated from adult B. tabaci using Biosol reagent (Invitrogen). cDNA synthesis was performed using iScript cDNA Synthesis Kit (BIO-RAD). Double-stranded RNA (dsRNA) of P450 CYP6CM1 was synthesized using specific primers (3' TAATACGACTCACTATAGGG 5', 3' TAATACGACTCACTATAGGG 5'), the bioassay tests after introduce of dsRNA into the insect body of whitefly by oral delivery were carried out for 6 days, and mortality was recorded daily by counting the dead insects at the bottom of the tube. The LC50 and resistance ratio were calculated using Ploplus computer software. The amount of cytochrome P450 activity was measured using 7-ethoxycoumarin based on the microfluorimetric method. Quantification of mRNA expression levels was quantified using the comparative cross-threshold (CT) (the PCR cycle number that crosses the signal threshold) method. Analysis of knockdown effects of CYP6CM1 on resistance was based on probit analysis and indicates that the gene is responsible for up to 5.3-fold reduction in imidacloprid resistance of dsRNA-fed adults. Moderate, but significant reduction in total P450 activity (45 %) exhibited by microsomal proteins prepared from dsRNA-fed JR population adult when compared to the control (JR population without dsRNA-fed). The results of P450 CYP6CM1 mRNA expression levels showed decrease in mRNA levels of the target genes with increasing the time after feeding dsRNA. Results revealed that delivery dsRNA to adult insect's reduced CYP6CM1 expression up to 2 -fold when comparing to the control. Reduction in resistance ratio by 5.3 fold after CYP6CM1 dsRNA fed in resistance population indicated the possibility of practical use of RNAi technique in insect resistance management (IRM).

This study was conducted to evaluate the effect of treatment by Carboxin Thiram fungicide and Imidacoloropride pesticide on storability and some indicators of seed germination and vigor of maize single cross hybrid 704 in laboratory of department of agriculture at Islamic Azad University in Karaj. Seeds were prepared from Kermanshah Agriculture and Natural Resources Research Centre. Seeds were treated by pesticide, imidacloprid in two rates, 3 and 6 g per kg of seed, fungicide Carboxin Thiram in the 2 and 2.5 per thousand, and combined 3 g Gaucho + 2 per thousand Carboxin Thiraman and non- seed treatment were as a control. Treated seed and control seed stored at room temperature (25°c) 3 months. Then standard germination test was conducted and final germination percentage (FGP) was evaluated, normal seedling percentage and some related traits of seed vigor including seedling length, primary root and shoot length, root and shoot dry weight, seedling dry weight, seedling length and weight vigor indices were measured and the experiment was conducted as completely randomized design with 4 replications. The results showed that highest percentage of seed germination was related to treatments of imidacloprid 6 g and the lowest percentage of seed germination was related to control (non- seed treatment), the highest and lowest meantime of germination and control respectively Carboxin Thiram was 2 per thousand. The highest, the lowest weight and seedling vigor index of 2 per thousand treated by imidacloprid 6 grams and Carboxin Thiram. Therefore it can be concluded that seed sterilization as a method to prevent accelerated aging, is disinfectant to maintain and improve seed quality.

In this study, the susceptibility of different larval instars of Colorado potato beetle, Leptinotarsa decemlineata to Biobit containing Bacillus thuringiensis var. tenebrionis Ber., as microbial and imidacloprid as novel chemicals and phosalone as conventional insecticides was investigated in laboratory conditions. Colorado potato beetles were propagated on potato leaves planted in pots and their 1st, 2nd, 3rd, and 4th larval instars’ susceptibility was determined by bioassay test. LC50 values of Biobit for L1, L2, L3 and L4 were defined as 252, 613, 1731 and 3006 ppm after 144 hours, respectively. Also, LC50 values for imidacloprid and phosalone after 72 hours were 17.58, 41.35, 56.76 and 81.27 ppm and 447, 698, 1020 and 1297 ppm, respectively. Older insect larvae were more resistant to microbial and chemical treatments. Also, Colorado potato beetle was more susceptible to imidacloprid then phosalone and Biobit.

The effect of mineral spray oil (MSO) and imidacloprid were compared to control Phyllocnistis citrella Stainton (Lep: Gracillariidae) and Panonychus citri and Phytoseiid predatory mites populations. The first experiment, the average number of mines per leaf by citrus leaf miner larvae in MSO treatment with 700 ml per 100 litres of water, imidacloprid (4 cc/2litres of water) and control were 0.27, 0.37 and 2.95, respectively. Percent larval mortality were 51.85, 37.83 and 26.10% , respectively and Percent pupae were 47.09, 59.4 and 73.8, respectively. The average number of mines per citrus leaf miner larvae in MSO treatments with 900 ml per 100 litres of water, imidacloprid (4 cc/2litres of water) and control were obtained 0.09, 0.3 and 2.9, respectively. Percent larvae mortality were 77.57, 60.06 and 26.1%, respectively and Percent pupae were 11.01, 36.23 and 75.32%, respectively. The second experiment, average number of eggs and developmental stages of Panonychus citri in control using imidacloprid at all sampling dates was significantly higher than the MSO spraying. On the other hand, the number of eggs and developmental stages of Phytoseiid predatory mites in MSO spraying were significantly higher than control using imidacloprid. The results showed that mineral oil was able to control citrus leafminer sufficiently and could be replaced the imidaclopridic pesticide in citrus orchards of Mazandaran province.

Natural and human hazards arising from the use of chemical pesticides to reduce pest damage are significantly increased. In this way, tend to use alternatives with similar efficacy and less risk like plant to control pests has increased. Therefore, it seems that plant compounds can be used as alternatives to chemical insecticides to protect agricultural products in the future. These compounds have no harmful and negative effects on nature and are safer than chemical insecticides; they decompose rapidly, do not remain in soil and water and have no effect on non-target populations. One of the important agricultural products around the world is potato and a major pest of it around the world and in Iran that damage the product is Colorado potato beetle, Leptinotarsa decemlineata (Say). Nowadays chemical control is the most common method to control of this pest but causes resistance. According to the Colorado potato beetle resistant to conventional chemical pesticides for controlling them, in recent year tendency to use insecticide with plant origin become more for this pest.One of the most important plant compounds are essential oils. Due to the low risk of essential oils to humans and the environment and their insecticidal effect, we motivated to investigate the insecticidal effects of three important medicinal plants on Colorado potato beetle for reducing the environmental hazards arising from the use of chemical insecticides.
Three insecticides thiamethoxam, diniteforane, imidacloprid were bought and three essential oils Satureja khuzistanica Jamzad, Ocimum basilicum L. and Mentha spicata L. were gathered in spring then dried in shade at room temperature and for later use in special plastic bags were stored at -24 ° C. With Clevenger essential oils were extracted. In the spring and summer 4th instars larvae of Leptinotarsa decemlineata Say from potato fields of Ardabil plain collected. Investigation against this pest in a completely randomized block design with four replications under field conditions was done. Mortalities were recorded at 1, 3, 5, 7, 9, 11, 13 and 15 days after spraying insecticides and essential oils. The control plants were treated with water. Data analysis was done in SPSS16 software and the mean of the data was compared with Turkey's test.
Result showed that in this study thiamethoxam had greatest effect on fourth instar larvae of Colorado potato beetle. In 15 cc a.i./ha of thiamethoxam in the environment after 15 days 95 % mortality happen . Imidacloprid and diniteforane after 15 days have 68 and 73.6 percent mortality respectively. Imidacloprid and thiamethoxam are two most common Colorado potato beetle insecticides that are used by farmers. Diniteforane is not so common insecticides in country. Also investigated showed that essential oil of S. khuzistanica had greatest effect on fourth instar larvae of Colorado potato beetle. In 15 cc a.i./ha of S. khuzistanica in the environment after 15 days 90.2 % mortality happen . O. basilicum and M. spicata after 15 days have 48 and 46 percent mortality respectively. Data showed that essential oils are highly selective and because of their effect (actopamin receptor) usually have no adverse effect on mammals. These compounds in contrast to synthetic carbamates, organophosphouros, and pyretroid that have adverse effect on the environment and people are safe for the environment.
Therefore, using plant material is effective step for reducing environmental risk of chemical insecticides that used for agricultural crop in country. In order to reduce the environmental hazards caused by the use of chemical pesticides, we can say: 1- Limit the use of chemical pesticides.
2. Use plant materials that are safe for humans and creatures.
3. Promote and educate the use of these compounds among farmers.
Acknowledgment
Thereby researcher thanks and appreciated from the Faculty of Agricultural Sciences of University of Mohaghegh Ardabili for doing this project.

The aphid, Macrosiphum rosae is one of the important pests of Rosa spp., feeds by sucking sap from plant which leads to leaves and shoots distortion and reduction of plant growth and crop productivity. In this study, the efficiency of botanical insecticide, palizin® was compared with the chemical insecticide, imidacloprid® in the laboratory and outdoor condition. The insecticides were evaluated at the maximum recommended field concentration: palizin 2000 ppm, imidacloprid 500 ppm and water was used as control. Spraying was done by a hand sprayer on both sides of Rose leaves until the leaves were covered completely by insectisides. The number of dead aphids was recorded at 24, 48 and 72 hours after treatment. To obtain the number of dead aphids, the live adults were counted at different times post treatment. According to the results, statistically significant difference found among treatments (P ≤ 0.05). The insecticides were noticeably decreased the number of M. rosae and caused mortality more than 90% in both conditions. However, there was no statistically significant difference between the mean mortality percentage when imidacloprid and palizin were compared. This shows that botanical insecticide, palizin can effectively control M. rosae and can be used instead of chemical insecticide, imidacloprid, in control programs of this pest.

In order to monitor canola stem borer weevils, Ceutorhynchus spp., determining the appropriate time for control, and investigate the efficacy of insecticides, this research was conducted in a RCBD with five treatments and four replicates in Sari during 2011-2012. Yellow water traps were used for monitoring the pest. The treatments were a) chlorpyrifos EC40.8% (2 l/ha), b) imidacloprid SC35% (1 l/ha), c) diazinon EC60% (1.5 l/ha), d) fenitrothion EC50% (1 l/ha) and e) control. Four plants per plot were collected 1 day before and 5, 14, and 21 days after treatment and the pest larvae were counted. One week prior to harvesting, the numbers of healthy pods (HP) and blind stalks (BS) on three plants per plot were counted. 1 m2 of the crop per plot was harvested, and the yield and thousand kernel weight (TKW) were measured. First and last weevils were caught in early November and late December, respectively and its peak occurred in late November. Oviposition began in late November and its peak occurred in early December. The efficacies of the treatments a, b, c and d at 14 days after treatment were 88.89±6.51, 57.57±9.61, 83.20±6.00, and 91.82±6.13 percentage, respectively. Compared to ghe control, TKW and yield increase in a, b, c, d were 0.8, 0.4, 0.48, and 0.43 g; 115.5, 68.2, 79.5, and 62.8 g, respectively. HP and BS in a, b, c, d and e were 77.17±11.63, 43.58±1.93, 44±9.10, 44.75±7.06 and 31.75±3.35; 4.50±0.29, 8.75±0.98, 13.25±1.42, 18.33±3.54 and 14.83±2.76, respectively. Chlorpyrifos with appropriate efficacy, had the highest yield, TKW, HP and the smallest BS.

Pesticides are considered as the most important pollutants in surface water and groundwater. Neonicotinoids are new group of insecticides, derived from nicotine. Their physicochemical properties render them useful for a wide range of application techniques, including foliar, seed treatment, soil drench and stem applications. Confidor, the representative of the first generation of neonicotinoid insecticides, was patented in 1985 by Bayer and was placed on the market in 1991. The Canadian Pest Management Regulatory Agency considers confidor to have high potential for surface water contamination, leaching to groundwater and persistence in soils. Biodegradation is one of the most effective ways to destroy pesticides in the environment. The application of Bioremediation techniques is taken into consideration as an option to reduce or remove pollutants from the environment due to their low cost, high efficiency and environmentally friendly features. Bioremediation by using microorganisms has not any adverse effect after cleanup. The accumulator microorganism species, haven’t pathogenic properties and aren’t the cause of disease on the other organisms. The selection of a biomass for using in bioremediation is very important, it should be abundant in environment and adapted to environmental conditions. The aim of this study was to investigate the ability of various species of Trichoderma fungi to remove Confidor from contaminated water influenced by variables like pH, concentration of the confidor and time.
In order to conduct this study three different fungal species belonging to the genus Trichoderma were used. The samples were transferred to PDA (Potato Dextrose Agar) sterile solid media for in vitro testing usage. The samples were kept in refrigerator at 4◦C temperature, after the fungal biomass reached to maximal growth; the colonies were transferred to new media and used in our experiments as resources. After complete fungal growth on the solid media, liquid media were prepared with the formula containing 250 g/l potato extract, 20 g/l dextrose and 0.25 g/l Tetracycline antibiotic (to prevent bacteria growth) in three pH (5,7,9) and three toxicant concentrations (1, 3 and 5 mg/l). Lactic acid and KOH (3%) were used to adjust pH in the prepared media. The degradation experiments were performed in a 50 ml falcon for 1 month. All experiments were maintained under similar conditions. The samples were shacken daily. After 1 month of incubation, aliquots (2 ml) were removed; centrifuged and the supernatants were used for the estimation of concentration of residual confidor by spectrophotometer. The results were analyzed by SPSS software.
According to the results T.harzianum with 60.34% confidor removal had the highest ability and T.tomentosum with 44.60% had the lowest ability to biological degradation of confidor from the polluted waters. The maximum confidor removal (75.89%) using T.harzianum was accrued to acidic media with 5 mg/l of confidor. The minimum confidor removal (53.09%) using T.asperellum was accrued to alkaline media with 1 mg/l of confidor. Using T.tomentosum the efficiency of confidor removal in media with pH=5 and concentration of 5 mg/l was increased by 10.95% and 15.63% compared to the environments with the concentrations of 3 and 1 mg/l, respectively. In the media containing T.harzianum, the percentage of confidor removal after 4 weeks was increased by 46.21% Compared to the first week. In the media containing T.harzianum, T.asperellum and T.tomentosum, the percentage of confidor removal after 4 weeks was increased by 46.21%, 37.06% and 32.84% respectively, Compared to the first week. Totally, the results showed that all the fungi species are capable to remove confodor. Toxicant concentration increasing from 1 mg/l to 5 mg/l, results in increasing the percentage of toxicant removal. The results of confidor removal from mediums with different pH demonstrated that in all studied fungi, toxicant removal at pH=5 is higher than other pH. The results obtained from this study confirm the hypothesis of positive effect of passing the time on confidor removal efficiency by different Trichoderma species.
In general, we can conclude that three species of studied Trichoderma in this research can be applied for bioremediation of agricultural waters which are contaminated by confidor. As a result, by collecting the agricultural water that are contaminated with confider and application of these fungi as biological purifiers, we will access to a considerable amount of non-conventional water resources to irrigate of downstream. It is noteworthy that Trichoderma species in addition to the biorefinery potential of pollutants , are able to improve soil structure and increase plant resistance.

Honey bee (Apis mellifera L.) colony collapse disorder (CCD) that appeared in 2005/2006 still lingers in many parts of the world. Here we show that sub-lethal exposure of neonicotinoids, imidacloprid or clothianidin, affected the winterization of healthy colonies that subsequently leads to CCD. We found honey bees in both control and neonicotinoid treated groups progressed almost identically through the summer and fall seasons and observed no acute morbidity or mortality in either group until the end of winter. Bees from six of the twelve neonicotinoid-treated colonies had abandoned their hives, and were eventually dead with symptoms resembling CCD. However, we observed a complete opposite phenomenon in the control colonies in which instead of abandonment, they were re-populated quickly with new emerging bees. Only one of the six control colonies was lost due to Nosemalike infection. The observations from this study may help to elucidate the mechanisms by which sub-lethal neonicotinoids exposure caused honey bees to vanish from their hives.

The leopard moth borer (LM), Zeuzera pyrina L., is a serious pest of walnut trees in semiarid regions of Iran. Chemigation, or irrigation in which an insecticide is incorporated into the irrigation water, is one strategy by which LM might be controlled. The experiment was carried out with five treatments in five replications in a completely randomized design in a 25 year-old walnut (variety Azarshahr at Kamalshahr) orchard in Karaj on 15 May, 2011. The treatments included imidacloprid SC350 at 20, 60, 100, 140 ml/tree and check (without spray). For sampling, 5 treated trees were randomly selected in each treatment. Ten annual branches were sampled in each tree and then the number of insect bore holes was counted in each 60 cm-branches individually. The mean numbers of bores per tree in imidacloprid treatments of 100 and 140 ml/tree were 14.25 and 8.25 bore holes, respectively, which were significantly fewer than the mean number of bores in the check (28). Lower imidacloprid treatments of 20 and 60 ml/tree had 32 and 38 bore holes per tree, respectively. Both of the last treatments could increase severity of LM infestation, whereas imidacloprid treatments of 100 and 140 ml/tree reduced LM infestation (50, 75%). The study showed that insectigation is a specialized method and should be carried out by a specialist knowledgeable about the physiochemical characters of the soil, tree physiology and pest biology; otherwise, this method can increase environmental pollution, LM infestation and the costs of pest control.

Field studies were conducted in Shahrekord and Lordegan towns of Chahar Mahal va Bakhtiari province, in two growing seasons from 2009 through 2011, to evaluate the effect of planting date, with and without a seed- treatment insecticide (Imidacloprid), on yield (biomass), yield components and control of maize Iranian mosaic disease (MIMD) with natural vectors in maize (Zea mays L.) Single cross 704 cultivar. The experimental design was a split plot arrangement of a randomized complete block with four replications. Main plots consisted of four planting dates, approximately 15 days apart from 10 May through 25 June. Sub plots consisted of a seed-treatment systemic insecticide application. In each of the two years, yields and yield components of plots planted in 10 May were reduced significantly by MIMD infection. Disease incidence in experimental plots varied between 2 and 44.5%. Planting dates of 5 June and 25 June resulted in the highest biomass and yield components in two years. Significant increase (P=0.01) in maize yield and yield components varying from 9.3% to 32 % was observed in plots treated with seed-treatment insecticide and the magnitude of increase depended on planting dates. Disease incidence was determined based on the percentage of plants (total plants per plot) exhibiting symptoms. Also, samples of plants from each of the experimental plots were collected and tested for presence of MIMV with TAS-ELISA method and the results were supported in both years of study. The highest populations of Laodelphax striatellus and Unkanodes tanasijevici were also observed when maize seedlings at the first planting date (10 May) were at three-leaf growth stage. Almost 3% plants in some plots were showed symptoms of infection other viral diseases such as Maize rough dwarf virus (MRDV), Wheat streak mosaic virus (WSMV) and Barley yellow dwarf virus (PAV and MAV) based on symptoms and ELISA test. In 2009, seven cultivars of maize, including: ZP677, ZP505, ZP684, Single cross 704, KONSOUR, KSC500 and TWC 647, were evaluated in view of their resistance level to MIMV, in Shahrekord and Lordegan regions. The highest and the lowest infection rates with MIMV belonged to Single cross 704 (57%) and KONSOUR (3.8%), respectively.