Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences
Author(s):
Abstract:
Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism’s transcriptome is related to its cellular proteome.
Keywords:
Language:
English
Published:
International Journal of Molecular and Cellular Medicine, Volume:3 Issue: 9, Winter 2014
Pages:
43 to 50
magiran.com/p1233942
دانلود و مطالعه متن این مقاله با یکی از روشهای زیر امکان پذیر است:
اشتراک شخصی
با عضویت و پرداخت آنلاین حق اشتراک یکساله به مبلغ 1,390,000ريال میتوانید 70 عنوان مطلب دانلود کنید!
اشتراک سازمانی
به کتابخانه دانشگاه یا محل کار خود پیشنهاد کنید تا اشتراک سازمانی این پایگاه را برای دسترسی نامحدود همه کاربران به متن مطالب تهیه نمایند!
توجه!
- حق عضویت دریافتی صرف حمایت از نشریات عضو و نگهداری، تکمیل و توسعه مگیران میشود.
- پرداخت حق اشتراک و دانلود مقالات اجازه بازنشر آن در سایر رسانههای چاپی و دیجیتال را به کاربر نمیدهد.
In order to view content subscription is required
Personal subscription
Subscribe magiran.com for 70 € euros via PayPal and download 70 articles during a year.
Organization subscription
Please contact us to subscribe your university or library for unlimited access!