فهرست مطالب
فصلنامه پژوهشهای علوم دامی ایران
سال دوازدهم شماره 1 (پیاپی 41، بهار1399)
- تاریخ انتشار: 1399/02/21
- تعداد عناوین: 10
-
- تغذیه نشخوارکنندگان
-
صفحات 1-17
مطالعه ای به منظور تعیین ارزش تغذیه ای گیاه آستاراگالوس پودولوبوس و مقایسه آن با چند گونه گیاه شورپسند آتریپلکس کانسنس (Atriplex canescens)، سالسولاریجیدا (Salsola rigida)، لیسیوم (Lycium barbarum)، و درمنه دشتی (Lycium barbarum) در قالب طرح کاملا تصادفی انجام شد. گونه های مورد مطالعه در سه مرحله رشد فنولوژیکی (رویشی، گل دهی و بذردهی) از منطقه داشلی برون گنبد کاووس جمع آوری شدند. نتایج نشان داد که در بین گونه های مختلف، از نظر ترکیب شیمیایی اختلاف وجود دارد (0/05>P). مقدار ماده آلی در دامنه 63/77تا 89/33درصد بود که بالاترین و پایین ترین مقدار آن به ترتیب در درمنه دشتی در مرحله گل دهی (89/33درصد) و گونه سالسولا در مرحله بذردهی (66/50درصد) مشاهده شد. بین گونه های مختلف از نظر پتانسیل و نرخ تولید گاز اختلاف وجود داشت (0/05>P)؛ بالاترین مقدار پتانسیل تولید گاز در مرحله رشد رویشی مربوط به گونه درمنه دشتی و در مراحل گل دهی و بذردهی مربوط به گونه آتریپلکس بود. گونه سالسولا پایین ترین مقدار قابلیت هضم ماده آلی، انرژی قابل متابولیسم و غلظت اسیدهای چرب کوتاه زنجیر را داشت. بین گونه های مختلف از نظر قابلیت هضم ماده خشک در مرحله رشد رویشی اختلاف وجود داشت (0/01>P). بالاترین و پایین ترین قابلیت هضم ماده خشک به ترتیب مربوط به گونه درمنه دشتی (58/66درصد) و آتریپلکس (50 درصد) بود. بالاترین مقدار عامل تفکیک در مرحله رشد رویشی مربوط به گونه سالسولا (7/37 میلی گرم بر میلی لیتر) و پایین ترین مقدار در مرحله بذردهی مربوط به گونه لیسیوم (3/42 میلی گرم بر میلی لیتر) بود. به طور کلی نتایج نشان داد که گونه های آستاراگالوس پودولوبوس و درمنه دشتی در مقایسه با سایر گونه ها، از قابلیت هضم ماده خشک، قابلیت هضم ماده آلی و تولید پروتئین میکروبی بالاتری برخوردار بودند.
کلیدواژگان: آستاراگالوس پودولوبوس، ارزش تغذیه ای، تولید گاز، گیاهان شورزیست -
صفحات 19-33
این پژوهش به منظور بررسی آثار همزمان سازی تخمیر شکمبه ای ماده مغذی بر فراسنجه های شکمبه ای، ساخت پروتئین میکروبی و تعادل نیتروژن در گوسفند انجام شد. ترکیبات شیمیایی به همراه فراسنجه های تجزیه پذیری پروتئین خام و کربوهیدرات علوفه یونجه، کاه گندم، دانه جو، دانه ذرت، تفاله چغندرقند، سبوس گندم و کنجاله سویا اندازه گیری شد. سه جیره با انرژی و پروتئین خام یکسان اما با شاخص همزمانی متفاوت شامل 0/64، 0/78 و 0/92 که با استفاده از فراسنجه های تجزیه پذیری مواد خوراکی محاسبه شده بودند، تنظیم شدند. از شش راس گوسفند 14 ماهه با میانگین وزن 1/17±30/17کیلوگرم دارای فیستوله شکمبه ای در قفس های متابولیکی استفاده شد. طرح آزمایشی در قالب طرح مربع لاتین تکرار شده در سه دوره و اختصاص دو گوسفند به هر جیره آزمایشی در هر دوره انجام شد. نتایج نشان داد که با افزایش شاخص همزمانی غلظت نیتروژن آمونیاکی شکمبه به ویژه در 1/5 ساعت بعد از مصرف خوراک کاهش یافت. غلظت کل اسیدهای چرب فرار در 3 ساعت بعد از تغذیه در جیره ای که بیشترین شاخص همزمانی را داشت بیشترین مقدار بود. با افزایش شاخص همزمانی غلظت کل اسیدهای چرب فرار به ویژه غلظت پروپیونات نیز افزایش معنی داری داشت. کل مشتقات پورینی دفع شده یا جذب شده و ساخت پروتئین میکروبی تحت تاثیر جیره های آزمایشی قرار نگرفت. با افزایش شاخص همزمانی کل نیتروژن دفع شده کاهش و بازدهی ابقاء نیتروژن افزایش یافت. هرچند در این پژوهش ساخت پروتئین میکروبی تحت تاثیر قرار نگرفت اما سایر نتایج مثبت از جمله بهبود تخمیر در شکمبه و ابقاء نیتروژن در بدن، استفاده از شاخص همزمانی را در تنظیم جیره های غذایی برای نشخوارکنندگان به ویژه گوسفندان قابل توصیه می نماید.
کلیدواژگان: ابقاء نیتروژن، تخمیر شکمبه ای، شاخص همزمانی، نیتروژن آمونیاکی، نیتروژن اوره ای خون -
صفحات 35-45
مطالعه ای به منظور تعیین ترکیب شیمیایی و تجزیه پذیری ماده خشک در قالب طرح کاملا تصادفی با 6 تیمار شامل: 1) دانه ذرت بدون عمل آوری (شاهد)، 2) دانه ی ذرت فلیک شده با بخار، 3) فلیک+مخمر، 4) دانه ی ذرت مایکروویو شده، 5) فلیک+ مایکروویو، 6) فلیک+مخمر+مایکروویو انجام شد. اندازه گیری ترکیب شیمیایی نمونه ها با استفاده از روش استاندارد تجزیه تقریبی انجام شد. تجزیه پذیری شکمبه ای این تیمارها با روش کیسه های نایلونی با استفاده از سه راس قوچ بالغ دالاق تعیین شد. نتایج این آزمایش نشان داد که فرآیند مایکروویو به تنهایی و یا همراه با سایر روش های عمل آوری منجر به افزایش مقادیر ماده خشک، ماده آلی، پروتئین خام، الیاف نامحلول در شوینده ی خنثی، الیاف نامحلول در شوینده ی اسیدی، کل مواد مغذی قابل هضم، انرژی خالص رشد و انرژی خالص شیردهی شد و بیشترین مقادیر در تیمار 6 مشاهده شد. مقایسه خصوصیات تجزیه پذیری تفاوت معنی داری را بین تیمارهای مختلف نشان نداد، هرچند بخش سریع التجزیه و کند تجزیه در تیمار 6 تفاوت قابل توجه غیر معنی داری نسبت به سایر تیمارها داشت بدین ترتیب که پایین ترین مقدار بخش سریع التجزیه و و بالاترین مقدار بخش کند تجزیه در این تیمار مشاهده شد. نتایج حاصل از این پژوهش نشان داد که روش های مختلف عمل آوری بر ترکیب شیمیایی دانه ذرت موثر هستند؛ هر چند بر فراسنجه های تجزیه پذیری تاثیر معنی داری نداشتند و ترکیب روش های عمل آوری فلیک+مخمر+مایکروویو می تواند در بهبود ارزش تغذیه ای دانه ذرت موثرتر از روش های دیگر باشد.
کلیدواژگان: تجزیه پذیری شکمبه ای، دانه ی ذرت، ساکارومایسس سرویزیه، عمل آوری، مایکروویو - تغذیه طیور
-
صفحات 47-60
این آزمایش به منظور تاثیر سطوح مختلف پودر گیاه دارویی کنگرفرنگی بر عملکرد، جمعیت میکروبی ایلیوم، غلظت آنزیم های کبدی و پاسخ ایمنی جوجه های گوشتی در شرایط تنش سرمایی انجام شد. تعداد 400 قطعه جوجه نر یک روزه سویه راس- 308 در قالب طرح کاملا تصادفی با پنج تیمار، چهار تکرار و 20 پرنده در هر تکرار به مدت 42 روز مورد استفاده قرار گرفتند. تنش سرمایی شامل اعمال دماهای 32، 25، 20 و 15 درجه سانتی گراد به ترتیب در 1، 7، 14 و 21 تا 42 روزگی بود. تیمارها شامل: شاهد (جیره بدون افزودنی)، آنتی بیوتیک (جیره شاهد به اضافه 0/0015درصد آنتی بیوتیک ویرجینیامایسین)، آسپیرین (جیره شاهد به اضافه 2/0 درصد پودر داروی آسپیرین) و تیمارهای حاوی یک و دو درصد از پودر گیاه دارویی کنگرفرنگی در جیره بودند. نتایج آزمایش حاضر نشان داد که پرندگان تغذیه شده با جیره های حاوی پودر کنگرفرنگی، مصرف خوراک و افزایش وزن بیشتر و ضریب تبدیل خوراک بهتری نسبت به سایر تیمارها داشتند (0/05>P). استفاده از دو درصد پودر گیاه کنگرفرنگی در جیره جوجه ها، سبب کاهش جمعیت اشری شیاکلای و افزایش جمعیت بیفیدوباکتریوم ناحیه ایلیوم در سن 42 روزگی شد. تیمار های حاوی دو درصد پودر کنگرفرنگی و آسپیرین سبب کاهش فعالیت آنزیم آلانین آمینوترانسفراز کبدی در سن 21 روزگی شدند. فعالیت آنزیم آسپارتات آمینوترانسفراز کبدی در پرندگان تغذیه شده با دو درصد پودر کنگرفرنگی در مقایسه با سایر جیره های آزمایشی در سن 21 روزگی کاهش یافت. تغدیه جوجه های گوشتی با جیره حاوی دو درصد پودرکنگرفرنگی، عیارآنتی بادی علیه گلبول قرمز گوسفند (SRBC) را در مقایسه با تیمار آنتی بیوتیک افزایش داد. پرندگان دریافت کننده جیره حاوی آنتی بیوتیک، کاهش جمعیت لاکتوباسیلوس و بیفیدوباکتریوم در سن 21 و 42 روزگی و افزایش جمعیت اشری شیاکلی را در سن در 42 روزگی در مقایسه با شاهد و دیگر تیمارها داشتند. با توجه به نتایج بدست آمده از پژوهش حاضر، استفاده از آنتی بیوتیک ویرجینیامایسین در جیره جوجه های گوشتی تحت تنش سرمایی دارای اثرات منفی بر جمعیت میکروبی مفید و افزایش اشری شیاکلی بوده، لذا سطح دو درصد پودر کنگرفرنگی به جهت بهبود جمعیت میکروبی و آنزیم های کبدی به عنوان جایگزین آنتی بیوتیک توصیه می شود.
کلیدواژگان: آنزیم های کبدی، تنش سرمایی، جمعیت باکتریایی، جوجه گوشتی، کنگرفرنگی -
صفحات 61-73
به منظور تعیین معادلات رگرسیونی پیش بینی مقادیر انرژی قابل متابولیسم در ارقام پر تولید جو ایرانی و مقایسه این معادلات با نتایج روش NIRS و ارقام مندرج در جداول (1994) NRC، سه آزمایش انجام شد. در آزمایش اول ترکیبات شیمیایی 10 رقم جو پرتولید ایرانی تعیین گردید. در آزمایش دوم، انرژی قابل متابولسیم به روش جمعآوری فضولات و با استفاده از نشانگر برای ارقام جو پرتولید ایرانی با جایگزینی 40 درصد جو در جیره پایه در سنین 10 و 24 روزگی جوجه های گوشتی نر به دست آمد. داده های حاصل از این دو آزمایش جهت تعیین معادلات پیش بینی مقدار انرژی قابل متابولیسم با استفاده از نرم افزار SPSS و رویه Enter مورد استفاده قرار گرفتند. معادلات پیش بینی میزان AMEn برای ارقام جو پرتولید ایرانی در سنین 10 و 24 روزگی به ترتیب به صورتAMEn= 407.87×EE + 27.27×NFE و AMEn= 271×EE + 33×NFE به دست آمد. جهت بررسی صحت و دقت معادلات به دست آمده، آزمایش سوم با استفاده از 400 قطعه جوجه نر سویه راس 308 در قالب طرح کاملا تصادفی با پنج تیمار و چهار تکرار و 20 جوجه در هر تکرار انجام شد.AMEn جو مورد استفاده در آزمایش سوم با استفاده از پنج روش زیر مشخص شد: 1- جدول (1994)NRC 2- معادله رگرسیون (1994) NRC 3- روش بیولوژی 4- معادلات رگرسیون به دست آمده از آزمایش دوم 5- با توجه به معادلات رگرسیون به دست آمده از روش NIRS. در تعیین AMEn جو، نزدیک ترین مقادیر به آزمایش بیولوژیکی از معادلات به دست آمده در آزمایش دوم حاصل شد که نشاندهنده صحت بالای این معادلات می باشد. به طورکلی بر اساس نتایج حاصل از آزمایش حاضر، استفاده از معادلات پیش بینی جهت برآورد دقیقتر AMEn جو در هنگام جیرهنویسی پیشنهاد می شود.
کلیدواژگان: انرژی قابل متابولیسم، جو، جوجه گوشتی، معادلات رگرسیونی پیش بینی -
صفحات 75-86
هدف از این پژوهش، بررسی اثر افزودن عصاره الکلی گیاهان دارویی سرخارگل و آویشن به جیره بر عملکرد، صفات لاشه و همچنین فراسنجه های بیوشیمیایی خون و وضعیت ایمنی جوجه های گوشتی بود. تعداد 160 قطعه جوجه یک روزه گوشتی سویه راس- 308 (نر و ماده به تعداد مساوی) د قالب طرح کاملا تصادفی در چهار تیمار با چهار تکرار و هر تکرار ده قطعه، تقسیم شده و پرورش یافتند. طول مدت تحقیق، 42 روز بود که به سه دوره پرورشی آغازین (10-1 روزگی)، رشد (23-11 روزگی) و پایانی (42-24 روزگی) تقسیم شد که تیمارهای آزمایشی از ابتدای دوره اعمال شدند. تیمارهای آزمایشی شامل 1- شاهد (جیره پایه(، 2- افزودن 0/2 درصد عصاره آویشن به جیره پایه، 3- افزودن 0/2درصد عصاره سرخارگل به جیره پایه و 4- افزودن مخلوط 0/2 درصد عصاره آویشن و 0/2 درصد عصاره سرخارگل به جیره پایه بودند که از روز اول به جوجه ها تغذیه شدند. خوراک مصرفی، وزن زنده و ضریب تبدیل غذایی جوجه ها به صورت هفتگی ثبت شد. در پایان دوره پرورش، یک پرنده نر از هر تکرار آزمایشی جهت خون گیری و تجزیه لاشه کشتار شدند. نتایج نشان داد که اثر تیمارها بر مصرف خوراک و افزایش وزن زنده جوجه ها در کل دوره معنی دار نبود. ضریب تبدیل خوراک جوجه ها به طور معنی دار تحت تاثیر تیمارهای آزمایشی قرار گرفت. به طوری که بهترین آن در گروه شاهد و بدترین آن در گروه سرخارگل بود. ویژگی های لاشه و وزن اندام های داخلی جوجه ها تحت تاثیر تیمارها قرار نگرفت. اثر تیمارهای آزمایشی بر عیار آنتی بادی علیه بیماری های نیوکاسل و آنفولانزا در جوجه ها معنی دار بود. کمترین آنتی بادی علیه نیوکاسل و بیشترین آنتی بادی علیه آنفولانزا در گروه آویشن مشاهده شد. افزودن عصاره های آویشن و سرخارگل به جیره باعث افزایش وزن در وزن غده بورس فابریسیوس جوجه ها نسبت به شاهد شد ولی بر وزن طحال تاثیری نداشت. افزودن عصاره های آویشن و سرخارگل باعث کاهش چشم گیر غلظت تری گلیسریدها و VLDL خون جوجه ها شد. تیمارهای آزمایشی تاثیر معنی دار بر تراکم گلبول های سفید خون شامل لنفوسیت ها، نوتروفیل ها و ایوزینوفیل ها نداشتند. به طور کلی، افزودن عصاره های آویشن و سرخارگل به جیره جوجه های گوشتی تاثیر معنی دار بر شاخص های عملکردی و ویژگی های لاشه نداشت، ولی باعث افزایش عیار آنتی بادی علیه آنفولانزا و کاهش سطح لیپیدهای خون شد.
کلیدواژگان: ایمنی، جوجه گوشتی، چربی های خون، رشد، گیاهان دارویی -
صفحات 87-101
از آن جا که دانش کافی درباره غلبه بر شرایط پرتنش طبیعی، با کمترین هزینه و بدون عوارض جانبی، در مرغ های تخم گذار مسن وجود ندارد، دو آزمایش با هدف بررسی اثر عصاره گیاه چای ترش، به عنوان یک پاداکسیدان طبیعی، بر سامانه ایمنی، فراسنجه های بیوشیمیایی خون، وضعیت پاداکسیدانی پلاسما و تعادل اکسیدانی مرغ های تخم گذار مسن در دوره های تولک و پس از تولک و نیز ارزیابی صفات عملکردی و کلسترول زرده تخم مرغ های تخم گذار در مرحله دوم تولید (بعد از تولک) طراحی شد. بعد از تعیین خواص پاداکسیدانی در مرحله پیش آزمایش، هر یک از آزمایش های اصلی با 200 قطعه مرغ تخم گذار سویه های-لاین W-36 در قالب طرح کاملا تصادفی انجام گرفت. در هر دو آزمایش، 5 تیمار آزمایشی به ترتیب شامل جیره شاهد، جیره پایه به همراه 300 و 700 میلی گرم در کیلوگرم عصاره برگ و جیره پایه با 300 و 700 میلی گرم در کیلوگرم عصاره کاسبرگ بود. برخلاف دوره پس از تولک، تلاش برای افزایش پایداری اکسیداتیو در دوره تولک موفقیت آمیز بود، به طوری که کاسبرگ چای ترش در سطوح 300 و 700 میلی گرم در کیلوگرم تعادل اکسیدانی و ظرفیت کل پاداکسیدانی پلاسمای مرغ های تخم گذار تولک رفته را به طور معنی داری بهبود بخشید. همچنین کاهش معنی دار گلوکز، کلسترول و تری گلیسرید خون در دوره پس از تولک و کاهش معنی دار کلسترول و تری گلیسرید خون در دوره تولک به وسیله سطح 700 میلی گرم در کیلوگرم عصاره برگ چای ترش مشاهده گردید. چای ترش بر صفات عملکردی و سامانه ایمنی تاثیر معنی داری نداشت.
کلیدواژگان: تولک بری، تیترآنتی بادی، چای ترش، مالون دی آلدهید - ژنتیک و اصلاح دام و طیور
-
صفحات 103-112
پرواپیوملانوکورتین (پومس) یک پروتئین پیش ساز در جوجه های گوشتی است که از 251 اسیدآمینه تشکیل شده است و در تنظیم غذای مصرفی و تعادل مصرف انرژی نقش دارد. هدف از انجام این پژوهش، تعیین چندشکلی ژن پرواپیوملانوکورتین و بررسی ارتباط آن با صفات رشد (که شامل وزن زنده، وزن لاشه، وزن سینه، وزن ران، وزن پشت وگردن، بال، کبد، قلب، بورس، طحال، پانکراس، پیش معده + سنگدان و چربی محوطه بطنی) در جوجه های گوشتی سویه راس وکاب بود. بدین منظور از تعداد 100 قطعه جوجه گوشتی سویه راس و 60 قطعه جوجه گوشتی سویه کاب نمونه خون تهیه و استخراج DNA به وسیله روش نمکی بهینه یافته صورت گرفت. پس از استخراج DNA، قطعه ای به اندازه bp444 از ناحیه اگزون دوم ژن پرواپیوملانوکورتین با استفاده از تکنیک PCR تکثیر گردید. جهت تعیین ژنوتیپ نمونه ها، از روش چندشکلی فرم فضایی رشته های منفرد (SSCP) و الکتروفورز محصولات تک رشته ای بر روی ژل پلی آکریل آمید و رنگ آمیزی توسط نیترات نقره انجام شد. برای ژن پرواپیوملانوکورتین در جوجه های گوشتی سویه راس دو الگو بنام E و F و در جمعیت جوجه های گوشتی سویه کاب نیز چهار الگوی A، B،C و D مشاهده شد. ارتباط چندشکلی این ژن با صفات رشد به وسیله رویه ی GLM نرم افزار SAS آنالیز شد و نتایج نشان داد که در جوجه های گوشتی سویه راس و کاب، قطعه 444 جفت بازی ژن پرواپیوملانوکورتین در جایگاه اگزون دوم دارای چند شکلی است. و هیچ یک از الگوهای مشاهده شده در ناحیه مورد مطالعه از ژن پرواپیوملانوکورتین، در هیچ کدام از دو جمعیت ارتباط معنی داری با صفات رشد ندارند.
کلیدواژگان: صفات رشد، ژن پرواپیوملانوکورتین، جوجه گوشتی، چندشکلی، PCR-SSCP -
صفحات 113-124
تنظیم اولیه و بهینه سازی پارامترهای ورودی روش های یادگیری ماشین گامی اساسی جهت دستیابی به حداکثر صحت پیش بینی ژنومی می باشد. در این تحقیق، جمعیت های ژنومی برای سطوح مختلف وراثت پذیری (0/05 و 0/2)، عدم تعادل پیوستگی (پایین و بالا) و تعداد متفاوت جایگاه صفات کمی (200 و 600) بر روی 29 کروموزوم شبیه سازی شد. جهت ایجاد نسبت های مختلف فنوتیپ آستانه ای دودویی، فنوتیپ افراد جمعیت مرجع وابسته به اینکه باقی مانده آنها کمتر از ē-1SDe (رویکرد اول) یا 50 درصد افراد جمعیت (رویکرد دوم) باشد کد یک (فنوتیپ نامطلوب) و سایر حیوانات کد صفر (فنوتیپ مطلوب) اختصاص داده شد. برای بهینه سازی پارامترهای ورودی مدل، سطوح مختلف تعداد SNP نمونه گیری شده (100، 1000 و 2000=mtry)، تعداد بوت استراپ (500، 1000 و 2000=ntree) و حداقل اندازه گره پایانی (1 و 5=node size) برای جنگل تصادفی و سطوح مختلف تعداد درخت (100، 1000 و 2000=ntree)، عمق درخت (1، 5 و 10=tc) و نرخ یادگیری (0/1 و 0/05=lc) برای Boosting در نظر گرفته شد. کمترین میزان خطای خارج از کیسه برای mtry برابر با 2000، ntree برابر با 1000 و node size برابر با 1 و کمترین خطای اعتبارسنجی در روش Boosting برای ntree، tc و lr به ترتیب 1000، 10 و 0/05 مشاهده شد. صحت پیش بینی ژنومی روش های جنگل تصادفی و Boosting با کاهش فنوتیپ نامطلوب (رویکرد اول) افزایش یافت. بطور کلی در تمام سناریوها روش Boosting عملکرد بهتری نسبت به روش جنگل تصادفی داشت که دلیل این امر را می توان لحاظ کردن اثرات متقابل بین نشانگرها، خود ترمیمی و قدرت بالای این روش در کاهش خطای مدل دانست.
کلیدواژگان: اعتبارسنجی، صفات آستانه ای، عدم تعادل پیوستگی، وراثت پذیری، یادگیری ماشین -
صفحات 125-133
اندازه بدنی یکی از ویژگی های مهم برای ارزیابی و دسته بندی اسب ها می باشد. تجزیه و تحلیل های انجام شده با مطالعات پویش کل ژنومی نشان داده است که اسنیپ (SNP) BIEC2-808543 یکی از مهمترین چند ریختی های تک نوکلیوتیدی مرتبط با ارتفاع و اندازه بدن اسب ها است. در این مطالعه، تعیین ژنوتایپ BIEC2-808543 برای 141نمونه اسب اصیل عرب به وسیله PCR-RFLP صورت گرفت. پس از استخراج DNA، واکنش زنجیره ای پلی مراز برای تکثیر قطعه 284 جفت بازی در ژن LCORL انجام شد. محصول PCR تحت تاثیر آنزیم برشی Alu1 در واکنش PCR-RFLP برای تعیین ژنوتایپ نمونه ها مورد بررسی قرار گرفت. نتایج نشان می دهد که الل T در اسب عرب تثبیت شده است و بر این اساس فقط یک اسب با ژنوتایپ CT یافت شد و بقیه دارای ژنوتیپ TT بودند. میزان FST برآورد شده حاکی از این است که توزیع فراوانی آللی و ژنوتیپی اسنیپ BIEC2-808543 در دو نوع اسب رده های کورس و زیبایی یکسان می باشد. مقایسه امتیازات داوری، نشان داد که اختلاف معنی داری بین امتیاز دست و پا و گردن در بین اسب های کورس و غیر کورس نمی باشد. در این مطالعه مشخص شد که اندازه دور قفسه سینه در اسب های کورس بیشتر از اسب های غیر کورس است و این اختلاف معنی دار بود
کلیدواژگان: اسب عرب، اندازه بدنی، BIEC2-808543، LCORL
-
Pages 1-17Introduction
[ Endemic plants of rangelands, especially key species and palatable ones are inevitable for improvement and development of rangelands. The grazing is a critical managing factor regarding to the resources conservation and quantitative and qualitative increase of plants production at the rangeland ecosystems. Rangelands are dynamic ecosystems and changing as a result of the environmental disturbances. Sustainable utilization of rangelands is obtained when the changes become known. The increase in population over the past few decades, due to the increased demand for livestock production, has increased the number of livestock in the rangeland, and as a result, the pressure on the rangelands, especially in arid and semi-arid areas, has damaged many rangelands. After the degradation of rangelands, one-year species, non-palatable and toxic species are replaced by the high quality and palatable species and therefore the quality and quantity of forage in most of the rangelands is by no means satisfactory. Many rangelands in arid and semi-arid regions have been affected by soil erosion and dust and greasy vegetation due to the lack of vegetation. In the vast array, rangelands cultivating non-domestic species have been imported, For example, in dry and semi-arid rangelands of northern of Golestan province, imported species of Atriplex cultivate which, despite proper forage production and other benefits, has some disadvantages, including gradual increase of soil salinity, lack of plant regeneration in the years after establishment which cause metabolic disorders in animals, negative effects on native plants, parasite organisms in planting areas and the destruction of the plant due to extreme cold, which will undoubtedly lead to an increase in economic costs after its destruction, as well as reducing fodder production. Therefore, in order to improve and revitalize dry and semi-arid rangelands, it is necessary to introduce, reproduce and deploy indigenous species with high adaptability and high yield.
Materials and MethodsPlant samples in different growth stages (vegetative, flowering and seeding) were collected from arid and semi-arid hilly loess soil located north of Golestan province, Gonbad-e Qabus (Dashli Borun). The Gonbad-e Qabus is located (55o 12 N, 37o 16 E) and 45 m above sea level. The mean annual rainfall amount is below 450 mm and mean annual temperature is above 20 °C. Samples of Astragalus podolobus, Atriplex (A. canesences), Salsola (S. rigida), Lyceum, Artemisia sieberi were taken and air dried at 60 °C for 48 h and milled to pass a 1 and 1.5 mm screen. Their nutritive value was evaluated through determination of chemical compositions and in vitro gas production techniques. Samples were tested in an in vitro gas production method (96 h incubation) and batch rumen culture system (24 h incubation). Rumen fluid was collected before the morning feed from three fistulated Dalagh male sheep (45 ± 2.5 kg live weight fed on a forage diet at a concentration of 40:60). In vitro gas production was measured in triplicate and for each replicate, a sample of 200 mg DM were used. The bottles were then filled with 30 ml of incubation medium that consisted of 10 ml of rumen fluid plus 20 ml of buffer solution and placed in a water bath at 39 °C. Gas production was recorded at 2, 4, 8, 16, 24, 48, 72 and 96 h. Total gas values corrected for blank incubation and gas values expressed in ml g-1 of DM. The asymptotic gas production system (A) and rate of gas production (c), organic matter digestibility (OMD), metabolizable energy (ME) and short chain fatty acids (SCFA). A medium similar to one developed for gas production was used for batch rumen culture system to measure pH, and NH3-N and in vitro digestibility. The pH of the media was measured after 24 h incubation. After 24 h incubation, the contents of each glass bottle were empty, strained through four layers of cheesecloth and then 10 ml of strained rumen fluid was acidified by 10 ml of 0.2 N HCl for determination of NH3-N using the distillation method. Finally, all contents remaining in the bottles were filtered through nylon bags, oven dried at 60 °C for 48 h and analyzed for IVDMD and IVOMD.
Results and DiscussionResults showed that there were significant differences among plants species for chemical composition. The OM content ranged from 63.77 to 89.33% for all species and Artemisia sieberi had highest and salsola had lowest at seedling stage. The results of the present study showed that there were significant differences among plants species on potential and rate of gas production. Artemisia sieberi and Atriplex canscens had highest potential gas production at flowering and seedling, respectively. Salsola had lowest OM digestibility, ME and ACFA concentration. There were significantly differences among different species on DM digestibilty vegetative stage and Artemisia sieberi and Atriplex had highest (58.66 %) and lowest (50 %) DM digestibilty, respectively. Salsola showed the highest value of partitioning factor at vegetative stage(7.37 mg/ml) and lycium showed the lowest value of partitioning factor at seeding stage (3.42 mg/ml).
ConclusionIn conclusion, results of current study showed that Astragalus podolobus has nutritive value as similar as Artemisia Sieberi. However, further investigation is needed in order to determine nutritive value of these species.
Keywords: Astragalus Podolobus, Gas Production, Halophyte Plants, Nutritive Value -
Pages 19-33Introduction
[1] The nutrient synchrony is synchronization of ruminal fermentation rate of energy and nitrogen which is a method to increasing microbial protein synthesis, improving nitrogen efficiency, decreasing urinary nitrogen excretion and improving animal performance. Microbial protein production is important for ruminants. Current concepts of ruminant nutrition focus on optimizing ruminal microbial protein synthesis. Microbial yield in rumen depends largely on the supply of carbohydrates and nitrogen in the rumen. Balancing the rate of supply of nitrogen and energy yielding substrates to rumen microbes has been proposed in order to maximize the capture of rumen degradable protein and to optimize microbial growth rate and its efficiency. A more efficient capture of rumen degradable protein would reduce the requirement for expensive undegradable protein sources and also reduce the excretion of urinary nitrogen which case to environmental pollution and economical losses. Synchronization index expressed as the ratio between the hourly degradability of nitrogen with organic matter or carbohydrates in the rumen where the highest value for the synchrony index is 1.0. This research was done to evaluate the effect of synchronizing the rate of carbohydrate and crude protein ruminal fermentation on ruminal fermentation products, microbial protein synthesis, and nitrogen balance and blood parameters in sheep which were fed with similar components or structure high concentrate diets.
Materials and methodsChemical compositions and degradability parameters of crude protein and carbohydrate for alfalfa hay, wheat straw, barley grain, corn grain, sugar beet pulp, wheat bran and soybean meal were determined. Three diets were formulated for feedlot male lambs with same energy and metabolizable protein but containing different synchrony index 0.64, 0.78 and 0.92 which calculated by using degradation parameters of carbohydrate and crude protein of feeds from the diet. The effects of synchrony index of diets by 6 rumen-fistulated sheep with an average weight of 30.17±1.17 kg in metabolic cages were assigned in a duplicate 3×3 Latin square design (2×3 animals; 3 periods). Samplings were done in 3 periods (each period containing 14 days for adaptation and 5 days for sampling). Rumen fluid was collected for 5 consecutive days in the end of each period and ruminal fermentation parameters containing pH, NH3-N and volatile fatty acids were determined. Urine of sheep was collected end of each period for 5 days and microbial protein synthesis was estimated by measuring purine bases also nitrogen balance was calculated from the values of nitrogen consumption and excretion. Bleeding (19th trial day) were done from sheep and blood parameters such as glucose, albumin and blood urea nitrogen were determined.
Results and discussionThere was no significant difference in ruminal pH among diets during fasting conditions or before feeding. Also there was no significant difference in ruminal pH between treatments at 3 or 6 hours after feed intake. With increasing synchrony index, ruminal NH3-N concentrate reduced especially at 1.5 and 3 hours after feed intake. Total volatile fatty acids highest at 3 hours after feed intake for diet had highest synchrony index. With increasing synchrony index, total volatile fatty acids concentration increased almost by 20 percent. Also the propionate concentrates increased not only before feeding but also at 3 hours after feeding. Total volatile fatty acids and propionate concentration showed a linear trend between diets at 3 hours after feeding. Purine bases such as allantoin, uric acid, xanthine and hypoxanthine, total purine derivatives excreted or absorbed also microbial protein synthesis not affected by experimental diets. With increasing synchrony index, total excreted nitrogen reduced but nitrogen retained and its efficiency increased. Blood parameters such as glucose, albumin and blood urea nitrogen not affected by treatments.
Conclusionwith increasing synchrony index of the diets, microbial protein synthesis did not increase but total volatile fatty acids concentration and retained nitrogen increased whereas ruminal NH3-N concentration and total excreted nitrogen decreased. However, increasing nutrient synchrony index in high concentrated diets did not show the expected desirable results such as increasing microbial protein synthesis however did not also show undesirable results such as animal health. Due to the beneficial effects as increasing in fermentation and decreasing nitrogen excretion or environmental pollution using the high synchrony index diets can be useful for feed formulation or providing the perfect mix of feed items to meet nutritional requirements of sheep.
Keywords: Blood urea nitrogen, Microbial protein, Nitrogen retained, Ruminal fermentation, and Synchronyindex -
Pages 35-45Introduction
Cereal gains are important source of energy in livestock diet due to high amount of starch they store in their endosperm, but there is a paradox in grains nutrition in ruminants. Without processing, most of grains, specially corn and sorghum, starch will not be effectively digested, but most of processing methods can increase starch degradability in rumen and therefore increase acidosis risk. The dynamic of starch fermentation in rumen is an important indicator of nutritional value of cereal grain in ruminants nutrition. Due to reduced loss of methane and heat, available energy supply for the animal is greater when starch digested in the small intestine compared to starch fermented in either the rumen or large intestine. Several chemical and physical methods are commonly used for feed processing; however, chemical processing methods have been criticized recently because of toxic chemical remnants. Physical methods such as grinding, rolling, steam flacking and newly microwave irradiation are commonly used for grain processing. Among these, steam flacking and microwave irradiation have been considered as the most favorite methods for horse and ruminants. Steam flacking can increase starch availability and therefore the rate of degradation in rumen, but microwave irradiation has the reverse effect, so that overall degradability and digestibility of starch will be decreased. Yeasts have been used in human food processing for a long time, but recently it has been received considerable attention as a potential method of animal feed processing method. Every processing method will affect the extent and location of starch digestion in a different way, but for ruminant nutrition, the aim of all methods should be to optimize the place and amount of starch digestion in the different parts of digestive tract, so that both the rumen fermentation and intestinal digestion have optimum rate and host animal can achieve the most effective rumen microbial growth and also high glucose absorption in small intestine. None of processing methods can show such a combined effect itself. Therefore, this study was conducted to investigate the effects of different combinations of physical and biological methods of processing on chemical composition and rumen degradability parameters of corn grain.
Materials and MethodsThis experiment was carried out in a completely randomized design with six treatments, each with three replicates. Experimental treatments includes: 1) un-processing corn grain (control), 2) Steam-flaked corn grain, 3) yeast treated and then steam-flaked corn grain, 4) microwaved (850 W for 3 minutes) corn grain, 5) yeast treated and then microwaved corn grain 6) yeast treated, steam-flaked and then microwaved corn grain. In order to treat with yeast, corn grains were mixed with solution of 4 percent yeast (Saccharomyces cerevisiae) in a 2:1 ratio and then incubated in 35°C for 24 h. Dry matter, organic matter, crude protein and crude fat were determined using AOAC standard methods, and NDF and ADF was determined. Dry matter degradability of samples was determined using nylon bag technique. Samples were placed in the polyester bags and incubated for 0, 3, 6, 12, 24, 36, 48, 72, and 96 h in the rumen of three mature Dalagh rams. Degradability parameters were estimated using non-linear model and all data were finally analysed using SAS (9.1) statistical software.
Results and DiscussionResults of this experiment showed that type of processing method had significantly effects on chemical composition. Processing methods including microwave irradiation increased dry matter, organic matter, crud protein, neutral detergent fiber, acid detergent fiber, total digestible nutrients, and decreased the amounts of ether extract, non-fiber carbohydrates and neutral detergent soluble fraction of corn grain. treatment have no significant effect on dry matter degradability of corn grain, however, methods including yeast treatment especially the combination of yeast, flaking and microwave methods caused a non-significant reduction in the effective degradability and rapidly degradable fraction and also an increase in slowly degradable fraction of corn grain. Both of non-combined methods (steam flacking or microwave irradiation) caused a reduction in slowly degradable fraction of corn grain. The highest amounts of rapidly degradable fraction were also observed in these two treatments.
ConclusionThe results of this study demonstrated a significant effect of different processing methods on chemical composition of corn grain and had considerable effects on rumen dry matter degradability. Based on these results, it can be concluded that wet or dry heat processing methods are not appropriate processing methods of corn grain for ruminants nutrition, whereas combination of yeast treatment with steam flacking and microwave irradiation can be considered as the most appropriate methods.
Keywords: Corn grain, Microwave, Processing, Ruminal degradability, Saccharomyces cerevisiae -
Pages 47-60Introduction
Medicinal plants play an important role in maintaining the health and performance of the poultry during stress. One of the most important medicinal plants is artichoke. Artichoke, the scientific name of Cynara scolymus and the Latin name Artichoks, is an herb of the chicory family of the oldest medicinal plants. The extract of this plant improves arthrosclerosis and liver damages. This experiment was conducted to investigate the effect of Artichoke medicinal herb on growth performance, microbial population, liver enzymes and immune response in broiler chickens under cold stress condition in a completely randomized design.
Materials and MethodsIn this experiment, 400 one day old broiler chicks of Ross 308 were used in a completely randomized design with five treatments, four replicates and 20 chicks in each replicate. Experimental treatments were control (basal diet), antibiotic (basal diet plus 0.0015 percent antibiotic virginiamycin), aspirin (basal diet plus 0.2 percent aspirin powder), 10 and 20 g/Kg artichoke powder. During the experiment (42 days), the chicks had free access to water and feed. The broiler chickens were exposed to a temperature of 32ºC at one-day-old, with stepwise reductions to 25 ºC, 20 ºC and 15 ºC on days 7, 14, and 21, respectively. At this point, a temperature of 15 ºC was maintained until the end of the experiment. At 21 and 42 days of each experimental unit, two birds were selected and the gastrointestinal tract opened in an aseptic condition adjacent to the flame. Using pre-sterilized aluminum foil pieces, 1 g of ileal contents was removed and added to tubes containing 9 ml of phosphate buffer saline and transferred to the laboratory to determine the population of Lactobacillus, Bifidobacterium and Escherichia coli (E. coli). The number of bacteria per gram of sample was calculated. At the end of days 21 and 42, the breeding period after two hours of starvation from each experimental unit of 2 birds were randomly selected and 2 ml blood was taken via a wing vein. Serum samples were isolated after blood coagulation and transferred to the micro tube and centrifuged for 10 minutes. The enzymes activity of Alanine Aminotransferase (ALT), Aspartate Aminotransferase (AST) and Alkaline Phosphatase (ALP) were measured. To assay the primary and secondary antibody responses against sheep red blood cell (SRBC), at 16 and 23d of age, 2 birds/replicate were immunized intramuscularly with 0.5 mL 10% SRBC. Blood samples were obtained from the brachial vein at 7d following each injection (days 23 and 30). Antibody titers against Newcastle virus were measured in serum samples by hemagglutination inhibition assay.
Results and DiscussionThe results indicated that the population of E. coli was not subjected to experimental diets at 21 days. Lactobacillus population was subjected to experimental rations at 21 days. The effect of experimental diet on Bifidobacterium population was significant at 21 days of age. The experimental diets containing antibiotics and aspirin reduced and increased Bifidobacterium population respectively. The effect of experimental diets on the population of E. coli was significant at 42 days of age. Both levels of artichoke reduced the population of E. coli by comparison with the control and antibiotic groups. The diet containing aspirin and antibiotics also reduced and increased the E. coli population, as compared to the control group. The effect of experimental diets on Lactobacillus population was significant at 42 days of age. Antibiotic diet lowered the Lactobacillus population compared with other experimental groups. The effect of experimental diet on bifidobacterium population was significant at 42 days of age. The diets of 2% of artichokes and antibiotics increased and decreased bifidobacterium population respectively. One reported in a study thatevaluated the phenolic compounds of leaf extract and their antimicrobial activity that the compounds in the plant's extract such as chlorogenic acid, cinnarin, luteolin-7 rhinosinus and sinarocide showed high activity for combat with organisms. Experimental treatments had significant effect on activity of liver enzymes. The treatments 2% artichoke and aspirin were reduced activity ALT at 21 days. The treatment 2% artichoke reduced the amount of AST enzyme compared to control and other experimental diets. The experimental diets had no effect on ALP at 21 days of age. The effect of experimental diets on blood enzymes at 42 days of age was not significant. The result of a study showed that artichoke extract reduced the concentration of AST and ALT in broiler chickens. Kraft (1997) stated that watery extract of artichoke significantly reduced the concentration of AST, ALT and ALP compared to control group. The effect of different diets on the antibody titer against SRBC in 2 stages (23 and 30 days) and Newcastle disease (at 7 days of injection and 7 days after blood donation) was not significant. According to the results of the present study, Rahimi et al. (2011) reported that the antibody produced against RBC of sheep between rations (containing 0.1% garlic and control) in both temperature conditions (normal temperature and cold temperature to create ascites) was not meaningful. The results of this study showed that the diets containing each plant and their interaction did not have a significant effect on the antibody titer against Newcastle disease. Feed intake and body weight were increased and feed conversion rate was decreased in artichoke powder received groups in comparison with other treatment.
ConclusionAntibiotics are used to prevent bacterial infections and improve the digestive system's health in the poultry diet. In this research, which was carried out under cold conditions, virginiamycin antibiotics not only had no positive effect on the ileum microbial population, but also compared with control treatment reduced beneficial bacteria and increased harmful bacteria. It is concluded that the inclusion of 2 percent of artichoke in broiler diet, under cold stress conditions had positive effect on microbial population, liver enzymes and immune response in comparison with control treatment and antibiotic treatment, therefore it can be recommended.
Keywords: Artichokes, Bacterial populations, Broiler chicken, Cold stress, Liver enzymes -
Pages 61-73Introduction
Cereals are the main sources of calorie in poultry diets and corn is the most common cereal in poultry feed formulations; however, in some countries such as Iran, corn is mainly imported from other countries. In addition to import-associated problems, high volatility of corn price has recently resulted in a marked tendency between Iranian poultry producers to use other alternative grains in their formulations. Among the other cereals, wheat, rye, and barley are the most frequently used grains in poultry diets from which, barley is
believed to be a great alternative for corn due to its high productivity and good compatibility to the climatic conditions of the country. Barley is one of the most abundant grains raised in various areas of Iran and could be included in the formulations instead of corn. However, the extreme variability in nutrient contents observed within and between different barley varieties makes it difficult to achieve a good nutrient balance in barleycontaining diets. The energy content of feedstuffs is a topic of high importance for poultry nutritionists since birds regulate their feed intake based on dietary energy concentration. There are different methods to determine metabolizable energy (AME) content of feedstuffs including energy balance bioassay (excreta or ileal digestabased methods), referring to the standard tables describing feedstuff compositions (NRC and FEEDSTUFF tables), indirect AME determination using near-infrared spectroscopy (NIRS) technique and the use of multivariate prediction equations. Energy balance bioassay is the most reliable but time-consuming and expensive method while nutritionists need relatively simpler and faster methods for accurate feed AME estimation. On the other hand, contents of standard feed-describing tables are mean values obtained in a variety of previous studies performed under climatic conditions differing fairly from those of Iran. Most researchers agree that the values presented in the tables are not reliable and generalizable due to the extensive variability of feed types and varieties. During the last decades, various AME-predicting regression equations have been suggested for different feedstuffs but the data used for exploiting the equations have been obtained from animals and feeds genetically different from the modern commercial strains and varieties. Therefore, updating the equations using animals and feeds of today seems to be necessary. This study aimed at developing prediction equations for AME of the most producing Iranian barley varieties.Materials and MethodsThree trials were conducted to develop regression predictive equations for apparent metabolizable energy (AME) of some of the most producing Iranian barley varieties in broiler chicken diets and to compare the outputs of the equations with the AMEn values estimated by infra-red spectrophotometry (NIRS) method as well as with the values published by the national research council (NRC, 1994). In the first experiment, 10 different barley varieties were analyzed for proximate composition. Then, in the second experiment, total tract AMEn values were determined for all of the barley varieties using 10 or 24-d-old broiler chickens and chromium oxide as an indigestible marker. Results of the two first trials were used to develop AMEn-predicting equations using SPSS software and "enter" procedure. To verify the accuracies of the predictive equations, the third trial was conducted using 400 broiler chicks in a completely randomized design consisting of five treatments with four replicates of 20 birds each. The AMEn content of the barley variety used in the third experiment was estimated according to the following five procedures: 1) The AMEn recommended by NRC (1994); 2) The AMEn predicted using the equation suggested by NRC (1994); 3) The AMEn values directly estimated in the balance trial (trial 2); 4) The AMEn values predicted by the equations developed in the 2nd trial; and 5) The AMEn estimated using NIRS method.
Results and DiscussionThe equations obtained for 10 and 24-d-old broilers were: AMEn= 407.87*EE+27.27*NFE and AMEn= 271*EE + 33*NFE, respectively. The results showed that the AMEn values
exploited from the equations developed in the energy balance assay produced the closest performance to that of the AMEn values estimated directly during the same trial.ConclusionAccording to our findings, predictive equations can be used for accurate estimating of barley AMEn value for broiler diets formulation. In addition, our results showed that the old AMEn values and AMEnpredicting equations published by NRC (1994) and FEEDSTUFF (2014) are not accurate at least for Iranian barley varieties evaluated in the present study.
Keywords: Barley, Broiler, Metabolizable energy, Regression predictive equations -
Pages 75-86Introduction
Nowadays, there is an increasing interest to use organic compounds in broiler chicken diets instead of antibiotics and other feed additives may cause deleterious effects on the poultry products consumers. Using medicinal plants have different effects on broiler life such as improving feed efficiency, augmentation of immunity, producing more desirable carcass and so on. The goal of this study was to investigate the effect of adding coneflower and thyme alcoholic extracts to diet on performance, carcass characteristics, internal organs weights and also some blood and immunity parameters of broiler chickens.
Materials and methodsOne hundred-sixty 1-d-old chickens (male and female) were randomly divided into four treatment groups with four replicates in each, and reared for 42 days. The treatments were: 1- control (basal diet formulated according to Cobb500 nutrients recommendation), 2- adding 0.2% thyme extract into basal diet, 3- adding 0.2% coneflower extract into basal diet, and 4- adding 0.2% of thyme+ 0.2% of coneflower extracts into the respective basal diets; starter (1-10 d), grower (11-23 d) and finisher (24-42 d) that were fed to the birds from the beginning. Experimental plants extracts were collected via UV-extraction method by ethanol followed by the rotary evaporation to eliminate the diluent. All the feeding and vaccination programs of chickens were in accordance with Cobb500 commercial strain recommendations. Feed intake, weight gain and feed conversion ratio of chickens were weekly recorded. At the end of the study, one bird of each replicate was slaughtered for carcass analysis and blood sampling. Blood parameters were assayed via spectrophotometer. Carcass parts and internal organs weights were expressed as a percent of carcass weight. The antibody titers against Newcastle and
Influenza diseases were assayed. Data were analyzed as a completely randomized design and the means comparison was performed by least significant different test.Results and DiscussionResults showed that the effect of treatments on the amounts of feed intake and weight gain of chickens over the study. Feed conversion ratio of chickens was significantly affected by the treatments where the lowest was observed in control group and the highest in coneflower group. Carcass traits (the weights of empty carcass, breast, thighs, abdominal fat and back) and internal organs weights (liver, heart, lungs, intestines and gizzard) were not affected by the treatments. The weights of body organs are basically affected by genetic potential that the used chickens were very close in this sight of view, and weight gain also among groups was not significantly different. Effect of treatments on antibody titers against Newcastle and influenza was significant. The lowest antibody titer against Newcastle and the highest against influenza were observed in thyme group. Both of coneflower and thyme were showed having stimulatory effect on antibody production in poultry, but the different effects observed in the present study may be due to the epidemic of
diseases and also the hygienic conditions of the farm. Adding coneflower and thyme into the diet increased the bursa of fabricius weight of chickens than the control, but it had no significant effects on spleen weight. It should be mentioned that the chickens in the present study were vaccinated according to the provider company recommendations and also a coccidiostat compound was used in the diet that they together can obstruct or interrupt on the expected beneficial effects of coneflower and thyme on immune parameters. Adding thyme and coneflower into the diet caused a marked decrease in blood lipids concentrations. One of the desired properties of medicinal plants is lowering the blood’s and carcass’s lipids that was observed in the present study. It is reported that these plants have some components suppressing the lipids synthesis in liver and also other ones effect on lipase enzymes activity in tissues. The treatments had no significant effects on the hematological parameters of chickens. Whereas there were no significant differences in the amount of daily feed intake and weight gain of chickens and also all of the environmental conditions for chicken were the same, therefore none of hematological parameters were affected by the treatments.ConclusionGenerally, adding coneflower and thyme extracts into the diets of chickens had not significant effects on their growth performance in the overall period of the experiment and carcass traits as well. Using coneflower and thyme extracts in broilers diets has a booster effect on the antibody titer against influenza, while no positive effects were observed for Newcastle disease. Adding coneflower and thyme extracts into the diet of chickens prominently decreased the all types of blood lipids. No synergistic effects were observed between coneflower and thyme extracts wherever they had a significant effect on assayed parameters.
Keywords: Blood’s lipids, Broiler chicken, Immunity, Medicinal plants, Performance -
Pages 87-101Introduction
Stress increases the need for antioxidants, decreases eggs production and weakens immune system of laying hens. Since there is insufficient knowledge about overcoming natural stress conditions with minimal cost and side effects in old laying hens, the medicinal herb contained flavonoid and polyphenolic compounds are concerned. Apart from estrogenic, antibacterial effects and cholesterol reduction property that will result to lower cholesterol deposition in poultry products and where calyx and leaf of Hibiscus sabdariffa
are known as potent antioxidant. Therefore, these experiments were designed to investigate the effect of Hibiscus sabdariffa extract as natural antioxidants on the immune system, blood biochemical parameters, plasma antioxidant status and the antioxidant balance of laying hens during molting and post-molting periods, also, laying performance and egg yolk cholesterol in the second phase of laying hen egg production.Materials and MethodsIn these experiments, aqueous-alcoholic extract of calyx and leaf of Hibiscus sabdariffa were prepared and sprayed on feed at levels of 300 and 700 mg/kg. One liter of %96
ethanol/distilled water mixture (30:70) were used to infuse 100 g each of the plant material (calyx or leaf) for 24 h. During the pre-experimental stage, minerals composition and antioxidant properties of Hibiscus sabdariffa were measured. Each of the main experiments, were conducted with 200 laying hens in a completely randomized design. In both experiments, five treatments consisted of control diet (basal diet), basal diet with 300 and 700 mg/kg of leaf extract of Hibiscus sabdariffa and basal diet with 300 and 700 mg/kg Hibiscus sabdariffa calyx extract. In both experiments, the blood cholesterol, total protein, triglyceride, LDL, HDL, glucose and malondialdehyde were evaluated by Spectrophotometer auto analyzer. In the end of each experiment, immune system and plasma antioxidant status for 2 samples from each replicate were determined. The egg production, egg weight, egg mass, feed intake and feed conversion ratio were recorded weekly. The egg malondialdehyde was determined during post molting period. In order to measure the level of yolk cholesterol and triglyceride, in the end of the experimental period, 2 samples were randomly taken from each replicate and after separating the yolks and mixing them, were analyzed by Spectrophotometer auto-analyzer with enzymatic method. The data were statistically analyzed with the general linear model by SAS software. The
mean differences between treatments were studied by Tukey's test.Results and DiscussionAlthough there was more vitamin C in the leaf compared to calyx, the antioxidant activity including total antioxidants, phenols and anthocyanins in calyx were higher than
leaf. In both experiments, plasma antioxidant status of laying hens in a dose-independent manner were improved. During post molt period, attempt to increase oxidative stability of plasma and egg yolk also, improving plasma antioxidant status by dietary supplementation of Hibiscus sabdariffa extract was not significant, however, the Hibiscus sabdariffa calyx at 300 and 700 mg/kg levels, significantly affected plasma MDA and total antioxidant capability during molting period. In both experiments, the relative increase in antibody titers and the ratio of heterophil to lymphocyte were observed by all treatments as compared to the Control treatments. Hibiscus sabdariffa showed to have no significant effect on performance parameters. Probably, the negative effect of polyphenol compounds found in Hibiscus sabdariffa on digestive enzymes decreased lipid, protein and carbohydrates digestibility, thus reduced feed intake, egg weight and total blood protein, insignificantly, blood glucose and cholesterol, significantly. Also, the Hibiscus sabdariffa, especially leaf, decreased the yolk cholesterol and triglyceride. On the other hand, supplementation of Hibiscus sabdariffa at 700 mg/kg, improved production performance following feed conversion ratio compared with Control treatment that's probably due to quercetin and daidzein phytoestrogens found in Hibiscus sabdariffa. It seems that some compounds in Hibiscus sabdariffa, including phytoestrogens and organic acids that has been reduced the negative effect of other Hibiscus sabdariffa components on the performance of laying hens.ConclusionIt can be concluded that Hibiscus sabdariffa, especially its leaves, which are discarded in most countries, including Iran, have the significant beneficial effects, such as anti-lipid effects, improvement of total plasma antioxidant and oxidative balance of old laying hens, with minimal cost and no significant negative effect on functional and immune parameters. It seems that finding of effective dose of Hibiscus sabdariffa is important to achieve layer hens’ maximum efficacy according to the test conditions and can economically be extended the range of its usage.
Keywords: Antibody titer, Malondialdehyde, Molting, Sour tea -
Pages 103-112Introduction
The central melanocortin system appears to be an important mediator of the actions of both leptin and insulin, which are key elements in the control of energy balance. Proopiomelanocortin (POMC) is a complex precursor protein that is proteolytically cleaved to a variety of biologically active and important neuroendocrine peptides. The POMC gene is expressed mainly in the anterior and intermediate lobes of the pituitary and in the arcuate nucleus of the hypothalamus, and at a lower level also in a wide variety of peripheral tissues and of brain regions in mammals. It produces many biologically active peptides via a series of enzymatic steps in tissue-specific manners, which have important roles in the regulation of appetite, sexual behavior, the movement of melanin produced from melanocytes in skin and the production of endogenous opioid peptides with widespread actions in the brain. In chicken, the POMC gene consisted of three exons and two introns and its protein has 251 amino acid residues with nine proteolytic cleavage sites, suggesting that it could be processed to give rise to all members of the melanocortin family, including adrenocorticotropic hormone and alpha-, beta- and gamma-melanocyte-stimulating hormones, as well as the other POMC-derived peptides.
Considerable evidence has been collected indicating that POMC mutations are associated with obesity.Materials and methodBlood samples were collected in EDTA vials from one hundred Ross and sixty Cobb broiler chicks, stored at -20 and their DNA was extracted using the modified salting-out chloroform method. Polymerase chain reaction (PCR) was carried out by specific primer pairs to amplify a 444bp fragment from a part of exon two of the Pro-Opiomelanocortin gene. The pattern of all samples was determined through single stranded conformation polymorphism (SSCP) analyses by Acrylamide gel using silver nitrate staining.
The associations between polymorphisms (patterns) and the growth traits (live and carcass weight, and the weight of breast, thigh, back and neck, wings, liver, heart, bursa of Fabricius, pancreas, paraventricular, gizzard and spleen) were evaluated using the GLM procedure of the SAS software.Results and DiscussionThe extraction or genomic DNA and amplification of 444bp fragment of Pro-Opiomelanocortin gene were successfully done and it was polymorph in both strains. Two different patterns were found in Ross strain, E and F patterns with the frequencies of 0.56 and 0.44, respectively. Four different patterns were found in Cobb strain, A, B, C and D patterns with the frequencies of 0.63, 0.09, 0.14 and 0.14, respectively. There was no significant association between the patterns and the growth traits. In Ross strain, the effect of genotype (pattern) tend o be significant for carcass weight (p value = 0.054) and the chickens with F pattern have more carcass weight than those with pattern E. In Cobb strain, chickens with B pattern tend to have better slaughter yields compared to other patterns. Our results revealed that Cobb strain has more diversity in the studied fragment of POMC gene than Ross strain.
ConclusionEnergy homeostasis and body weight (BW) are regulated by coordinated actions of multiple genes. For significant economically traits, improvements in BW can be achieved through mass selection whereas feed conversion is relatively more difficult to improve. Gene polymorphisms can be used for improvement of the production traits by genetic selection, if the allelic association with the traits be determined. The variable associations of the identified polymorphisms may be a result of the differences in the population characteristics,
sex, or both, indicating that the selection criteria may influence the production trait associations. This should be taken into consideration while selecting for the desired production traits. Additional studies are required to expand the genetic and physiological aspects involved in feed intake, digestion, and metabolism. The genomic diversity also has important implications in the evolutionary dynamics of species. Investigations of polymorphisms are useful for better understanding of the gene function, and those associated with commercially significant production traits have a potential for usage as molecular markers for selection programs. In summary, the identified polymorphisms and their associations with the traits of economic importance in the present study provides greater insight into the role POMC gene involved in energy balance in poultry and points toward the
potential application of the findings for the enhancement of production traits by marker assisted selection.Keywords: Broiler chicks, Growth traits, PCR-SSCP, Polymorphism, Pro-Opiomelanocortin gene -
Pages 113-124Introduction
The development of genotyping technologies has facilitated the genetic progress of breeding programs by implementing genomic selection (GS). In fact, the accuracy of genomic evaluations has been enhanced via GS and quickly spread in livestock breeding. For several decades, most phenotypic variation in dairy cattle populations had focused on continuous traits especially milk yield. From an animal breeding perspective, pay attention to this category of traits because of negative correlation with novel functional traits leads to reduction in genomic merit of these traits. Considerable advances along with increasing economic benefits in modern animal breeding programs requires better understanding and the direct inclusion of novel functional traits. Since many prominent traits in livestock including disease resistance and calving difficulty, present a binary distribution of phenotypes (and are often termed threshold traits), thus these traits are important in animal breeding due to importance of animal welfare and human tendency for healthy and high quality products. Threshold nature of most functional traits, affected by multiple genes, non-compliance from Mendelian inheritance and normal distribution are challenges for accurate prediction of GEBV using statistical methods in such kind of traits. Machine learning methodology as a non-parametric method commonly extended to solve the challenges of genomic selection for threshold traits. Random Forest (RF) and Boosting are powerful machine learning methods in order to recognize gene-gene, protein-protein and gene-environment interactions, to detect disease associated genes, to model the relationship among combinations of markers, to select genes associated with the target trait, to identify the regulatory factors in or protein and DNA sequences, to classify various samples in gene expression of microarrays data and to improve accuracy of genomic prediction. The objective of current study was to investigate the role of threshold phenotype rate of training set and different genomic architecture on performance of RF and Boosting methods. In this regard, per-determined and tuning input parameters of each method is a basic step to achieve maximum genomic accuracy.
Materials and MethodsA population of 2090 animals genotyped for 10,000 markers was simulated using QMSim software. In the first phase, over a time span of 1,000 generations, a historical population was provided from 1045 females and 1045 males. In the second phase, in order to produce a realistic level of LD, bottleneck was used. For this purpose, the population size decreased over 100 generations to 209 individuals. In the third phase, the population size increased over 100 generations (2030 females and 60 males). All 2090 individuals of the last historical generation served as founders and using a random mating design expanded the recent population by simulating an additional 10 generations. During these generations, replacement ratio was set at 0.2 and 0.50 for females and males, respectively and selection of candidate individuals were based on EBV and age. Each mating produced only one offspring with a same probability of being either male or female. Individuals of generations 6 to 9 was used as training set, while the whole generation 10 was considered as validation set. Genomic population were simulated to reflect variations in heritability (0.05 and 0.20), linkage disequilibrium (low and high) and number of QTL (200 and 600) for 29 chromosomes; therefore, four different scenarios including I (10K SNP, h2 = 0.20, LD = low and 600 QTL), II (10K SNP, h2 = 0.2, LD = low and 200 QTL), III (10K SNP, h2 = 0.05, LD = low and 200 QTL) and IV (10K SNP, h2 = 0.05, LD = high and 200 QTL) were simulated. In order to create different rates of discrete phenotype, the animals phenotype of training set was coded as1 (inappropriate phenotype) depending on whether their phenotype residuals was less than the average of residuals ( ) or - 1 for the first and second approachs, respectively, and other individuals was defined ascode 0 (appropriate phenotype). In order to tuning input parameters of the model, different levels of mtry (100, 1000 and 2000), ntree (500, 1000, 2000) and nodesize (1 and 5) for RF and ntree (500, 1000, 2000), tc (1, 5 and 10) and lc (0.1 and 0.05) for Boosting were considered.
Results and DiscussionThe least of out-of-bag (OOB) error was obtained for mtry= 2000, ntree= 1000 and nodesize= 1 in RF method while the least of cross validation (CV) error was observed for boosting method with mtry= 2000, tc= 10 and lc= 0.05. In all scenarios, RF algorithm was showed a wide range of genomic accuracy (0.287 to 0.57) compared to Boosting method (0.4 to 0.58). Accuracy of genomic predicted was decreased in RF and Boosting with increasing the inappropriate phenotype, because of more individuals are in the vicinity of the average normal population for the first approach ( )compared to the second approach ( - 1 ), therefore leads to more classification errors (coding)and decrease of the genomic prediction accuracy. RF and Boosting showed a high performance when high-heritability traits were controlled by a large number of QTLs. Increase in number of QTLs generally led to a major improvement in RF accuracies, while a negligible positive effects were found for Boosting.
ConclusionThe composition of training set and population genomic architecture were two basic factors affecting accuracy of genomic prediction in machine learning methods. Interactions among predictive variables (SNP), self-healing and high potency to decrease training error were considered in Boosting method resulting in more accurate estimation in this method compared to the other RF method under all scenarios
Keywords: Cross validation, Heritability, Linkage disequlibrium, Machine learning, Threshold traits -
Pages 125-133Introduction
Body size is one of the main features for the classification of horses. Among these features, the length of the body is one of the aspects that considered essential for animal's nutrition and height at withers applies for intra-species separating. Genome Wide Association Studies have demonstrated LCORL gene code a transcription factor that those polymorphisms are associated with skeletal frame size and body length. Recently, BIEC2-808543 SNP located upstream of LCORL was identified as a genetic diagnostic marker associated with withers height and also the length of Cannon bone in Thoroughbred horses. BIEC2-808543 is This SNP effect on TFIID binding site in TATA box. The substitution of C to T allele causes changes affinity of TFIID to TATA box. because of this is the effect on indicating TFIID by a pro-motor nuclear element which is the first step in mRNA transcription and in result effects on other transcription factors of bone-like AP-1, activator protein-1 transcription factor complex, AP-1 is activated as one complex of mRNA and subsequently transcription get higher. On the other words, skeletal bones are expanded by three chondrocytes, osteoblasts and osteoclasts cells. The difference and performances of these cells are regulated by some special factors that are effective on gene expression.
Near the LCORL gene in chromosome 3, there is a QTL which is associated with height at withers, composition of legs, length of horse' s rump, head and jaw of the horse. The purpose of this research was studying of genotype and allele frequency of BIEC2-808543 and its relationship with body size in Iranian Arab horse.Materials and methodsA total of 152 (85 males and 67 females) Iranian Arab horses were used in this study. All horses were born between 1990–2015, and the mean of age was 7.3 years. All horse's data were registered at WAHO and was get from Yazd Arabic Horseshoe. The time of this research was 1396 and the information was gathered from horse breeding clubs in the city of Ashkezar. The city of Ashkezar is the center of Arabic horse breeding. Measurements included withers height (cm), chest circumference (cm), and leg length. Also, each horse was judged as view of foot, head and neck and score of 0-20 was registered. The referee of this research was experienced experts in the Iranian horses' club located in Yazd. Blood samples were collected from 141 animals and in the molecular genetic laboratory of Islamic Azad University of Ashkezar stored at −20°C. Genomic DNA was extracted by Gene All kit (Company Gene All, South Korea (according to the manufacturer’s protocol. We used Thermocycler for PCR and duplication fragments. The volume of the reaction was 25 μl including 14 μl master mix, 1 μl forward, 1 μl reverse, 9μl water. Genotyping for BIEC2-808543 was performed using by PCR-RFLP by Alu1 (Company Sina Clone) restriction enzyme. primer designing was applied primer 3 software and the Restriction Mapper software (Online site was used) for PCR was used to distinct the used restriction enzyme. Forward primer sequence has TGGAGTCAGTTGGGTTTAATG and Reverse primer sequence has GACCGGATAGCATAGAGAGAG. Genetic association analysis for withers height, chest circumference, leg length, and judgment scores were performed using SNPassoc package (R software). compare mean between race and show horse was performed using Non-parametric mann-whitneyU. Weir&Cocker ham'sFst was estimated by FSTAT software.
Results and discussionResults of Genotyping of BIEC2-808543 SNP showed that one of the horses with the name of Meraj Mofidian (father name: Zelzeleh) is CT. The others were TT genotype. In this study 99/2% of horses had the TT genotype. Results represent fixation of T allele of BIEC2-808543 SNP on this gene in Iranian Arab horses. There was no significant difference between scores in three aspects, hands, legs, head and neck of show and race horses. Also, Genotype frequency of BIEC2-80543 SNP of show and race horse was similar. Estimated FST between race and show horses was tiny amount (-0.005) and show no genetic difference of LCORL gene between two groups. Though there was no significant difference of withers height, and leg length and judgment scores between race and show groups.
ConclusionAllele T in BIEC2-808543 polymorphism in Iranian Arab horse stabilization and approves endurance of this breed. Race Iranian Arab horse have bigger Chest circumference because of racing in short distances.
Keywords: Arab horse, BIEC2, 808543 SNP, Body size, LCORL