فهرست مطالب nafiseh davati

Nowadays, the occurrence of antibiotic-resistant bacterial strains in food is increasing, which makes antibiotic treatment of infected food more difficult. One of the food sources that can cause foodborne infection is dairy products made from raw milk and one of the bacteria resistant to various antibiotics is Salmonella. The aim of this study was to investigate the presence of antibiotic-resistant Salmonella species in Poosti and Koozeh cheeses produced from raw milk in western Iran. For this purpose, the probable Salmonella species were isolated in Koozeh cheese from Bukan and Poosti cheese from Lorestan and Kermanshah. After initial phenotypic identification and biochemical testing, molecular identification was performed by amplification of the 16S rRNA gene with primers U1492R and B27F. The isolates were tested for resistance to tetracycline, oxacillin, penicillin and ampicillin. The results confirmed the presence of Salmonella enterica subspecies Typhimurium in all three cheeses among 14 Enterococcus isolates. The species of all three cheese were resistant to oxacillin, penicillin and ampicillin and the identified species of Lorestan Poosti cheese were resistant to tetracycline. But the identified species in Kermanshah Poosti cheese and Bukan Koozeh cheese were sensitive to tetracycline. The results of this study indicate that local Poosti and Koozeh cheeses in some western parts of the country may be carriers of antibiotic-resistant Salmonella strains and that in case of microbial infection caused by contaminated cheese, treatment with antibiotics may be difficult.

In this research, in-vitro time- kill curve effect of nano-ZnO loaded nanoliposomes against Bacillus cereus (ATCC 11778) and Pseudomonas aeruginosa (ATCC 9027) were evaluated. Thin layer hydration sonication and heat methods were evaluated to preparation of nano-ZnO loaded nanoliposomes at different level of lecithin: nano-ZnO ratio (5:1, 15:1, and 25:1 w/w). The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of nano-ZnO loaded nanoliposomes and free nano-ZnO against Bacillus cereus and Pseudomonas aeruginosa were determined. Results showed that the encapsulation of nano-ZnO in nanoliposome systems significantly increased their antimicrobial activities. Nano-ZnO loaded nanoliposomes were prepared at the highest ratio of lecithin: nano-ZnO ratio (25:1 w/w) showed higher antimicrobial activity compared to those prepared by heat method. From the time- kill curves, the log phase growth of Escherichia coli (8 hours) and Staphylococcus aureus (7 hours) in the medium containing nano-ZnO loaded nanoliposomes prepared through the thin layer hydration sonication at the highest level of lecithin: nano-ZnO ratio (25:1 w/w) at MIC and MBC values decreased to 3 and 3 hours and to 1 and less than 1 hours, respectively.

The objective of this study was to in-vitro investigation of antimicrobial activity effect of nano-ZnO loaded nanoliposomes at different level of lecithin: nano-ZnO ratio (5:1, 15:1, and 25:1 w/w) against Escherichia coli (ATCC 2592) and Staphylococcus aureus (ATCC 25923). Nano-ZnO loaded nanoliposomes were prepared through thin layer hydration sonication and heat methods. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of nano-ZnO loaded nanoliposomes and free nano-ZnO against Escherichia coli and Staphylococcus aureus were determined and their antimicrobial activities were evaluated by time- kill curve analysis. Results showed that the encapsulation of nano-ZnO in nanoliposome systems significantly increased antimicrobial activities of them by increasing their penetration into the microbial cell. Nano-ZnO loaded nanoliposomes were prepared through thin layer hydration showed higher antimicrobial activity compared to those prepared by heat method. From the time- kill curves, the log phase growth of Escherichia coli (8 hours) and Staphylococcus aureus (7 hours) in the medium containing nano-ZnO loaded nanoliposomes prepared through the thin layer hydration sonication at the highest level of lecithin: nano-ZnO ratio (25:1 w/w) at MIC and MBC values decreased to 5 and 4 hours and to 2 and less than 1 hours, respectively.

When Salmonella enterica serovar Typhimurium, a foodborne bacterium, is exposed to osmotic stress, cellular adaptations increase virulence severity and cellular survival. The aim of the gene network analysis of S. Typhimurium was to provide insights into the various interactions between the genes involved in cellular survival under low water activity (aw). We performed a gene network analysis to identify the gene clusters and hub genes of S.Typhimurium using Cytoscape in three food samples subjected to aw stress after 72 hours. The identified hub genes of S. Typhimurium belonged to down-regulated genes and were related to translation, transcription, and ribosome structure in the food samples. The rpsB and Tig were identified as the most important of the hub genes. Enrichment analysis of the hub genes also revealed the importance of translation and cellular protein metabolic processes. Moreover, the biological process associated with organonitrogen metabolism in milk chocolate was identified. According to the KEGG pathway results of gene cluster analysis, cellular responses to stress were associated with RNA polymerase, ribosome, and oxidative phosphorylation. Genes encoding RNA polymerase activity, including rpoA, rpoB, and rpoZ, were also significantly identified in the KEGG pathways. The identified motifs of hub DEGs included EXPREG_00000850, EXPREG_00000b00, EXPREG_000008e0, and EXPREG_00000850. Based on the results of the gene network analysis, the identified hub genes may contribute to adaptation to food compositions and be responsible for the development of low water stress tolerance in Salmonella. Among the food samples, the milk chocolate matrix leads to more adaptation pathways for S. Typhimurium survival, as more hub genes were down-regulated and more motifs were detected. The identified motifs were involved in carbohydrate metabolism, carbohydrate transport, electron transfer, and oxygen transfer.

The aim of this study was to isolate thermostable amylase producing bacteria from starch-rich wastewater of one of the canning factories and then molecular identification of these isolates. In addition, the thermostable amylase extracted from the bacterium was investigated for the optimum temperature and pH of enzyme activity. In this study, 14 heat-resistant microbial isolates were isolated from wastewater and only two isolates had amylase activity.  Molecular identification of isolates based on amplification of 16S rDNA gene by B27F and U1492R primers and then sequencing of PCR product confirmed the presence of Bacillus pumilus and Bacillus safensis. The results showed that the optimum temperature and pH of amylase activity were 60°C and 7, respectively, and Bacillus safensis 7.67 (U/ml) had more amylase activity than of Bacillus pumilus 6.33 (U/ml).

Amylase improves the texture and sensory properties of bulky bread by degrading starch and producing dextrin in order to faster metabolism by bakery yeast. This study investigates the effect of thermostable α-Amylase 0, 1.9, 2.9 (U/ml), extracted from Bacillus safensis, and fermentation time at 35, 40 and 45 minutes on the quality of bulky bread baked in oven at 210°C for 20 min. The results of our study showed that adding filtered soup containing   1.9 (U/ml) and fermentation for 40 minutes  was more acceptable than other samples in terms of volume, hardness, cohesiveness and overall acceptance, but adding more amounts of amylase enzyme at 2.9 (U/ml) level did not yield good results in terms of texture and sensory properties of bulky bread.

Recently, the production of fermented products has received significant attention due to health benefits. Doineh is a cereal- dairy based fermented product that is often traditionally prepared in the western regions of Iran. The aim of this study was to investigate the effect of adding 8% turnip, 8% pumpkin as a nutritious supplement and different amounts of bakery yeast 0, 0.5 and 1% to achieve an optimal formulation with a good texture and low microbial flora during 9 days fermentation. The results showed that the treatments of turnip, pumpkin and bakery yeast improved the texture and reduced microbial flora of doineh. The viscosity of doineh samples containing bakery yeast increased and in contrast, the growth of pathogenic bacteria and pH significantly (p<0.05) decreased compared to the control. While, water and oil adsorption showed no significant difference ( p<0.05) in the samples. Based on the results, formulations containing 1% bakery yeast and 8% Turnip are suggested because of better texture and better control of microbial spoilage.

The presence of antibiotic-resistant genes in local cheeses is not desirable due to the risk of gene migration, increased resistance to antibiotics in consumers, and therefore the effectiveness of related drugs during the treatment period. Recently, the studies showed that the demand of local cheeses made from raw milk have increased. However, there is concern that consumption of these cheeses could increase the risk of antibiotic-resistant genes transfer through bacteria especially Enterococcus spp to consumers. Of course, traditional fermented products may contain intrinsic microbial flora with unique useful properties, including the production of antimicrobial metabolites and resistance to phages, which is very important for the dairy industry. The ability of bacteriocin production by the microbial flora that responsible for fermentation of cheeses made from raw milk is very important because it prevents the growth of pathogenic bacteria. Therefore, the aims of this study were the evaluation of the presence of antibiotic-resistant microbial flora of local cheeses made from raw milk and the investigation of the useful properties such as the presence of its antimicrobial metabolites.

Cheese made from raw milk was produced based on a traditional recipe. For isolation of Enterococcus spp., KAA agar was used, followed by incubation for 48 h at 37°C. The serial dilution of cheese was carried out until the final dilution of 10-8 in ringer. For isolation of Enterococcus spp., a 100 µl of diluted sample was cultured on KAA agar, then incubated for 48 h under anaerobic conditions at 37°C. The catalase-negative and Gram-positive isolates were phenotypically distinguished at genus level using physiological tests )growth at salt concentrations 6.5% and 18%, pH 9.6 and 4.4, temperatures 10°C and 45°C and gas production. After phenotypic detection of isolates at genus level, culture-dependent characterization through PCR and subsequently sequencing was carried out. DNA extracted from cheese was proliferated and sequenced by NGS technique. The metagenomics data were processed for phage resistance, antibiotic resistance, bacteriocin and antioxidant components production. Furthermore, antibiotic resistance of isolates and antimicrobial properties of cell free supernatant (CFS) from cheese were evaluated.

A total of 20 bacteria were isolated from cheese and molecularly identified as Enterococcus malodoratous (60%), Enterococcus faecalis (5%), Enterococcus duran (5%), Enterococcus spp. (30%). Also, the metagenomic analysis showed that Enterococcal community of cheese include Enterococcus malodoratous (72%), Enterococcus faecalis (6%), Enterococcus italicus (13%), Enterococcus spp. (10%) and its microbiome is resistance to ‌-antibiotics ‌and bacteriophages and has the production potential of antioxidant compounds and antimicrobial compounds such as plantaricin. Moreover, laboratory tests confirmed ‌‌antibiotics resistance and antimicrobial properties of isolates.

This study showed that some local cheeses can be responsible for transferring antibiotic-resistant genes to humans and consumption of these cheeses should be limited.

Eve’ yogurt is one of the nutritive dairy products in Iran. The aim of this study was molecular identification of lactic acid bacteria isolated of ewe yogurts from 3 different regions of Iran (Mashhad, Dezful, and Hamedan) and assessment of their technological properties. A total of 47 isolates were molecularly identified by PCR of 16S rDNA gene and sequencing. Isolates were evaluated for technological properties including Lactic acid and diacetyl production, lipolytic, urease, and proteolytic activities. The statistical analysis of data using SPSS software indicated that diacetyl production and pH changes by bacterial isolates for 24 hours were significantly (P<0.05) different among yogurts from Dezful, Hamedan and Mashhad. The technological properties of isolates demonstrated that Streptococcus salivarius subsp. thermophilus (H1, H2) and Lactobacillus delbrueckii subsp. bulgaricus (H1, H2, H3, H7, H9, H10) of ewe’s yogurt from Hamedan have high technological properties. Also, based on the analysis results of the organoleptic properties and texture stiffness of yogurts produced by selected isolates, S. salivarius (H2) and L. delbrueckii (H3) suggested as a suitable starter culture.

The consumption of local and traditional dairy products have increased in recent years and some local cheeses as functional foods with desirable organoleptic attributes have positive effects on human health. However, there is concern that consumption of these products may increase the risk of exposure to food born bacteria such as Enterobacteriaceae family, Staphylococcus aureus, and Listeria monocytogenes. The microbiome of fermented products such as cheese is one of the most powerful and important parameters in flavor development and ripening. Furthermore, cheese flavor formation as a dynamic biochemical process is related to environmental conditions including milk source, ripening time, and temperature of storage. These parameters affect the microbial community structures and metabolic pathways.

In this study, a local cheese made from cow milk was prepared based on a local recipe. The traditional cheese was manufactured using mesophilic starter culture. The cheese was ripened at 10°C for 3 months. The samples were collected from the surface of the cheese. The serial dilution was performed until 10-10 dilution in sterile ringer. For isolation and phenotypic identification of lactic acid bacteria, a 100 µl of diluted sample was cultured on MRS agar and M17 agar, followed by incubation at 37°C for 48 h under anaerobic conditions with Gas-Pak A. After purification of colonies, the Gram-positive and catalase-negative isolates were phenotypically identified at genus level using physiological tests including capacity of gas production, growth at different pHs (9.6 and 4.4), salt tolerance (%6.5 and 18%), and different growth temperatures (10°C and 45°C). DNA extraction was performed with DNeasy®Blood & Tissue Kit. The microbial population of the cheese and its functional potential for ripening were investigated by whole-metagenome sequencing. The prepared library using Nextera™ DNA approach was sequenced by using the Illumina HiSeq® 2000, 2×100 bp paired- end reads. The metagenomics data of cheese microbiome were analyzed for taxonomic profiling and functional potential by De Novo Assemble Metagenome and Bin Pangenomes. The metabolic pathways were extracted from the KEGGdatabase.

The results of phenotypic identification showed that most of the lactic acid bacteria strains belonged to Streptococcus, Lactococcus, and Lactobacillus. Also, the results of metagenomics analysis showed that there were various genera including Streptococcus, Lactococcus, Lactobacillus, Acinetobacter, Enterococcus, Glutamicibacter, and Weissella in cheese. Streptococcus thermophilus, Lactococcus lactis, and Lactobacillus helveticus were identified as dominant species. Pathogenic bacteria such as Enterobacter, Listeria, and Staphylococcuswere also slightly found and therefore there is nearly no concern for consumers and human health. The microbiome of this cheese showed the metabolic potential for the biosynthesis of a wide range of  aroma compounds and associated with flavor development that related with the metabolism and biosynthesis of methane, branched chain amino acids (isoleucine, valine, and leucine), aromatic amino acids (tyrosine, tryptophan, and phenylalanine), other amino acids (beta-alanine, L-lysine), fatty acids (arachidonate, palmitate, stearate), and monosaccharides. The enzymes related to biosynthesis and metabolism of amino acids were found during ripening of this cheese. These enzymes included 4-hydroxy-tetrahydrodipicolinate reductase, 2-isopropylmalate synthase, 3-dehydroquinate dehydratase, 3-hydroxyisobutyryl-CoA hydrolase, 5-carboxymethyl-2-hydroxymuconate delta-isomerase, and 3-hydroxyacyl-CoA dehydrogenase. Based on the results of KAAS (KEGG Automatic Annotation Server), proteins involved in metabolic pathways of microbial community on the surface of the traditional cheese included Cytochrome P450 Photosynthesis Proteins, Peptidases & Inhibitors, Glycosyltransferases, Lipopolysaccharide Biosynthesis Proteins, Peptidoglycan Biosynthesis and Degradation Proteins, Lipid Biosynthesis Proteins, Protein Kinases, Polyketide Biosynthesis Proteins Prenyltransferases, Protein Phosphatases & Associated Proteins, and Amino Acid Related Enzymes. The cheese under our study as a functional food showed health benefits for consumers due to the presence of probiotic bacteria and genes encoded for biosynthesis of valuable compounds including antibiotics, drugs, and antioxidants.

Today, because of the side effects of chemical preservatives, it is suggested to use natural antimicrobial compounds such as essential oils. The antimicrobial activities of essential oils are well recognized for many years. In this study, after preparation of Artemisia absinthium essential oil, its components were identified by Gas chromatography–mass spectrometry (GC-MS). Then antibacterial activity of the essential oil was evaluated against Staphylococcus aureus, Escherichia coli, Salmonella typhi and Bacillus cereus by agar disk-diffusion, MIC and MBC methods. Based on MIC results, essential oil concentrations of 16, 32 and 64 (µl/ml) were selected to evaluate its efficacy in inactivating the growth of pathogenic bacteria on fresh lettuce. Lettuce was inoculated with Staphylococcus aureus, Escherichia coli, Salmonella typhi and Bacillus cereus and the bacterial count were enumerated at time intervals (0 h, 3 h, 24 h, and 72 h). The concentration of (Z)-β-Ocimene oxide as the major component of the essential oil was 76.53±2.36%. The results of MIC, MBC values and agar disk-diffusion showed that the most sensitive and the most resistant bacteria were Staphylococcus aureus and Escherichia, respectively. Compared to control (water), lettuce treated with 64 µl/ml essential oil at 72 h after treatment showed an up to 3.36, 2.27, 3.23 and 3.47 log CFU/g reductions in Staphylococcus aureus, Escherichia coli, Salmonella typhi and Bacillus cereus, respectively. This research showed that Artemisia absinthium essential oil may be an effective antimicrobial agent to the Control of pathogenic bacteria growth on fresh lettuce.

Nowadays, More people are interested in consuming organic products. Many of the organic foods and dairy products are produced by rural people and nomads in Iran. Some people are concerned about using of the contaminated organic foods with pathogenic microorganisms, because some of these organic foods are produced under poor hygienic conditions. On the other hand, many native strains of probiotic bacteria especially lactic acid bacteria can be found in these organic foods. In this study, the microbial community and sanitary quality of ewe’s drinking yogurt produced by Somar region nomads, by using culture dependent molecular method and next-generation sequencing (NGS), as a new tool for the culture independent molecular characterization of bacteria, were assessed. A total of three Ewe's drinking yogurt samples were collected from the nomads of Somar region in Iran under sterile conditions. For phenotypic identification of lactic acid bacteria, a volume of 0.1 milliliters of appropriate dilutions was cultured on MRS agar and M17 agar media. The plates were incubated at 37oC under anaerobic condition with Anaerocult® A for 48 hours. Typical LAB characteristics colonies were purified by streaking method on MRS agar and M17 agar. The catalase negative and Gram positive isolates were selected as presumptive lactic acid bacteria for phenotypic identification to the genus level. These isolated bacteria were tested for growth at 100C and 450C in MRS and M17 broth, gas production from glucose, growth in the presence of 6.5% and 18% of NaCl, growth at pH 4.4 and pH 9.6 and arginine hydrolysis. Isolates were identified by amplification of the 16S ribosomal RNA gene by Polymerase Chain Reaction and ribosomal DNA sequencing as a culture dependent molecular method. After DNA extraction of isolates, PCR was performed using prokaryotic 16S rDNA universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3). In the next step, the culture-independent molecular method based on next-generation sequencing of 16S ribosomal RNA gene amplicons was applied. The V3 and V4 regions of 16S ribosomal RNA gene were amplified using Forward Primer 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and Reverse Primer 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC Overhang adapter sequences were appended to the primer pair sequences for compatibility with Illumina index and sequencing adapters. The Illumina overhang adapter sequences to be added to locus‐specific sequences were: Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐ [locus- specific sequence] Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus- specific sequence]. Both contained an Illumina adapter region for sequencing on the Illumina MiSeq System. Then, Illumina sequencing on MiSeq was performed. The fastq files from the next generation sequencing were analyzed with BaseSpace (cloud‐based software, MSR: Metagenomics, version: 2.4.60.8). This metagenomics analysis classified organisms from V3 and V4 amplicon using a database of 16S rRNA data and performed a taxonomic classification using the Greengenes database showing species level classification in a graphical format (http://greengenes.lbl.gov/). The analysis output was a classification of reads at several taxonomic levels: kingdom, phylum, class, order, family, genus, and species. The analysis results included tables, cluster pie charts, phylogenetic trees and bar charts. The average and error bars of the relative abundance (%) of bacterial species from ewe’s milk and yogurt were calculated using Microsoft Excel 2010 software. A total of 40 bacteria as lactic acid bacteria were isolated from ewe’s drinking yogurt. Among isolated bacteria, two different genus of lactic acid bacteria were phenotypically characterized as 88% Lactobacillus, 3.5% Pediococcus and 8.5% Non-lactic acid bacteria. Isolates were identified by ribosomal DNA sequencing as Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus.
The microbial community from ewe’s drinking yogurt were identified on the basis of Next-generation sequencing (NGS) at genus level as 94.08% Lactobacillus, 1.07% Pediococcus, 0.33% Streptococcus, 0.20% Enterococcus, 0.11% Candidatus Blochmannia, 0.11% Alkalibacillus, 0.06% Cohnella and 3.02% unclassified. At species level 24.82% Lactobacillus equicursoris, 51.81% Lactobacillus delbrueckii, 3.61% Lactobacillus apis, 2.79% Lactobacillus ultunensis, 0.86% Lactobacillus taiwanensis, 0.85% Lactobacillus gigeriorum, 0.42% Pediococcus argentinicus and 13.64% unclassified were identified. Findings of this study have provided fundamental knowledge on sanitary quality and microbial composition of drinking yogurt produced by Somar nomads. Both phenotypic and molecular identification methods showed Pediococcus and Lactobacillus genus as the dominant genera in these samples. Molecular identification results showed Lactobacillus delbrueckii as the dominant species. Four species, Lactobacillus delbrueckii, Lactobacillus apis, Lactobacillus ultunensis and Pediococcus argentinicus were identified by both cultivation-dependent and cultivation-independent (NGS) methods. Rather, culture-dependent and culture-independent methods were found to be complementary in describing the microbial community of the ewe’s drinking yogurt produced by Somar nomads. The next-generation sequencing was found to be more accurate method in detecting the microbial diversity of drinking yogurt. The results showed poor hygienic quality of ewe’s drinking yogurt from Somar nomads, but there were no pathogenic bacteria in this product.

Studies have shown that camel milk and its fermented products have therapeutic properties and high nutritional value. Lactic acid bacteria play important role in Fermented dairy products. The aim of this study is to determine the lactobacillus community of camel milk. A total of 9 Lactobacillus were isolated from camel milk of Golestan province in Iran. The log10 CFU of Lactobacillus per ml on MRS medium under anaerobic condition at 20, 37 and 450C included 8.792± 0.14, 8.301±0.07 and 7.301±0.03 respectively. Isolates were identified on the basis of Biochemical and Phenotypic Characteristics as Lactobacillus paraplantarum, Lactobacillus ferintoshensis, Lactobacillus brevis, Lactobacillus pantheris, Lactobacillus johnsonii, Lactobacillus mali. Presence of Lactic acid bacteria was confirmed by band formation of PCR product in 1500 bp (amplification 16S rRNA gene using B27F-U1492Runiversal bacterial primer). Evaluation of their technological properties of isolates showed that isolated Lactobacillus fromcamelmilkhave lipoliticy, Proteolytic activity and high acidifying activity (except for Lb. mali and Lb. johnsonii). Also, allisolates, except Lb. Johnsonii, have autolytic activity in fair level. Based on technological properties ofisolates, Lb. paraplantarum, Lb. Brevis and Lb. pantheris are suggested as good candidates for camels milk processing or other fermentation process.

Camel milk is amongst valuable food sources in Iran. On the other hand, due to the presence of probiotic bacteria and bacteriocin producers in camel milk, probiotic bacteria can be isolated and identified from this food product.. The objectives of the present research were the isolation and molecular identification of lactic acid bacteria from camel milk and evaluation of their probiotic properties.. A total of ten samples of camel milk were collected from the Golestan province of Iran under aseptic conditions. Bacteria were isolated by culturing the samples on selective medium. Isolates were identified by amplification of the 16S rDNA and Internal Transcribed Spacer (ITS) region between the 16S and 23S rRNA genes by Polymerase Chain Reaction (PCR) and were then screened and grouped by the Amplified Ribosomal DNA Restriction Analysis (ARDRA) method. To evaluate probiotic properties, representative isolates of different ARDRA profiles were analyzed. The antimicrobial activity of Lactic Acid Bacteria (LAB) against Pediococcus pentosaceus, Escherichia coli and Bacillus cereus was examined by the agar diffusion assay. Acid and bile tolerance of isolates were evaluated.. A total of 64 isolates were analyzed based on biochemical tests and morphological characteristics. The most frequently isolated LAB was Enterococci. Weissella, Leuconostoc, Lactobacilli and Pediococci were less frequently found. Based on restriction analysis of the ITS, the isolates were grouped into nine different ARDRA patterns that were identified by ribosomal DNA sequencing as P. pentosaceus, Enterococcus faecium strain Y-2, E. faecium strain JZ1-1, E. faecium strain E6, E. durans, E. lactis, Leuconostoc mesenteroides, Lactobacillus casei and Weissella cibaria. The results showed that antimicrobial activity of the tested isolates was remarkable and P. pentosaceus showed the most antibacterial activity. In addition, E. durans, E. lactis, L. casei and P. pentosaceus were selected as probiotic bacteria.. This study revealed the presence of bacteriocin-producing bacteria and probiotic bacteria in camel milk from the Golestan province of Iran..