جستجوی مقالات مرتبط با کلیدواژه « morphometric » در نشریات گروه « دامپزشکی »

One of the most practical and accurate diagnostic imaging methods is computed tomography (CT) scan, which can be used to examine bones and joints in small animals.

This study aimed to evaluate the morphology, morphometry, and anatomy of the stifle joint of the Persian cat based on the CT images.

This descriptive cross-sectional study examined 10 clinically healthy adult Persian cats (5 males and 5 females) with a mean age of 2.4 years and a mean weight of 4.7 kg. To prepare CT images, the anesthetized Persian cat put on the CT scanner plate in a dorsoventral position. While the hind limbs of the cat were fully extended and kept towards the back, the sagittal, transverse and dorsal scans were taken at 2-mm intervals from the distal third of the femur to the proximal third of the tibia in the lateral and anterior posterior planes.

Based on the results, the CT method can help identify most of the anatomical structures of the stifle joint without the use of contrast material. The bones were white due to their high density, medullary cavity were dark, and muscles and tendons were visible in different gray scales on the CT images. The posterior cruciate ligament, the anterior and posterior ends of the lateral meniscus, and the posterior end of the medial meniscus were well identifiable in the sagittal reconstruction. Collateral ligaments, anterior cruciate ligament, and the middle part of the menisci were better seen in the dorsal plane. The only anatomical structure that was not identified in the multiplanar reconstructions was the anterior end of the medial meniscus. The medial and lateral parts of fabella were clearly visible under the tendons of the gastrocnemius muscles. Bony structures and infrapatellar fat pad could also be identified on the CT images.

The anatomical structure of the stifle joint of the Persian cats is similar to that of house cats. The CT images can be used for teaching anatomy, interpretation of CT scan images, and diagnosis of musculoskeletal complications and treatment of Persian cats.

The nematodes which belong to Haemonchus genes have high ability to show genetic and morphological changes. They can live with convenient adaptation in different hosts.
A Morphologic and Morphometric comparative study on Haemonchus nematodes from domestic ruminants in the southeast of Iran and comparison of studied parameters with the results of other researches around the world.
During an annual period the 100 adult Haemonchus nematodes (50 male and 50 female) were collected from each domestic ruminant (sheep, goat, cattle and camel) from Nehbandan (southern Khorasan), Zabol and Zahedan (Sistan and Balouchestan) in the southeast of Iran. In present study the measured parameters are: Total body length of male and female adult nematodes, gubernaculum length, right and left spicule length, the distance between spicule spine and the spicule posterior end, the distance between anterior cervical spine and the anterior end of nematode, the egg diameters. Also, the anterior sections were observed in order to study the longitudinal cuticular ridges (Synloph). The achieved data from nematodes of each host were compared with others using (One Way Anova and Tukey tests), also such comparison was done with the results of one of the standard sources (Soulsby 1982) using One Sample T Test.
The results of present study showed that some of the parameters such as spicule length, distance between right spicule spine and the spicule posterior end, and Synloph pattern in nematodes from sheep and goat are mostly similar to Haemonchus placei. The significant statistical differences in present study results showed high polymorphism in Haemonchus nematodes in the area.
It seems that such high polymorphism in present nematodes, especially from sheep and goat has been created due to mating of native nematodes and foreign species with the source of imported cattle.

The foramen magnum (FM) is an important landmark of the skull base and a transition zone between spine and skull as well as its close relationship to the brain and the spinal cord. So the FM has gained considerable interest due to its comparative anatomy, ontogeny, clinical, and animal breeding viewpoints.
The aim of this study was to determine morphology and morphometry of the occipital area of 20 mature and immature male Khouzestan river buffaloes.
7 parameters of the occipital area and the shape of the FM in the skull of 20 mature and immature male Khouzestan river buffaloes were analyzed.
The FM had 4 shapes including round, egg, oval, and tetragonal. In the mature and immature groups, the highest frequency of the FM shape belonged to oval. In the mature and immature groups, the tetragonal FM shape and the oval FM shape had the lowest frequency, respectively. The mean of the width, the length of the FM and the index of the FM in mature group was 38.60± 2.70, 35.34± 2.33, and 92.26±26 mm, respectively and 40.67± 1.51, 36.35± 2.33, and 90.23±3.65 mm in immature group, respectively. Amongst of the all parameters, the width and the length of the jugular process only differed significantly between mature and immature groups.
The variations of the FM shape in river buffalo were more than those of reported animals. The mean of the length and the width of the FM, the jugular processes width, the length of the jugular process, the length and width of the occipital condyles of male river buffaloes were greater than those of reported animals. The index of the FM in river buffalo was less than 100, which corresponded with the findings in rabbit, German shepherd and Pekingese dogs.

Fish are constantly exposed to various pathogens and parasites in particular. Gyrodactylus from Platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. Gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in Cyprinids. The present study aimed to identify morphometric and molecular characteristics of Gyrodactylus parasite on Carassius auratus (Linnaeus, 1758). Gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. The morphometrical characterization of Gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. The molecular species description was based on polymerase chain reaction (PCR) of partial sequence of 5.8S region of ribosomal RNA (5´CGATCATCGGTCTCTCGAAC3´) and partial sequence of internal transcribed spacer2 (ITS2) of ribosomal RNA (5´TTAAGGAAGAACCACTAGAG3´). Gyrodactylus species morphology identification was performed using Yamaguti (1961) identification key. The nucleotide sequences of the PCR products were compared with GenBank sequences. Based on morphometric analysis and sequencing, the Gyrodactylus specimens were described as Gyrodactylus kobayashi. Combination of molecular techniques with morphological analysis seems to be the best approach to identification of Gyrodactylus spices.