سیدعلی رضا سلامی

 Cannabis sativa L. contains valuable cannabinoids necessary for industrial, nutraceutical  and pharmaceutical applications. To ensure the availability of cannabis plant materials in vitro culture approaches guarantee rapid and mass production to meet the growing demand. On the other hand, callogenesis can also guarantee the production of secondary metabolites in vitro through suspension cell culture. The goal of the current study was to compare different basal culture media and plant growth regulator combinations to offer the best conditions for inducing callus formation in medical cannabis.

 Leaf explants were placed on MS and DKW basal culture media were used along with B5 vitamins, 30 g/l sucrose, and 7 g/l of Agar, together with various concentrations of plant growth regulators, including 2,4-D (2, 5, and 8 µmol/l) and BA (0.5 and 2.5 µmol/l).

 The calli appeared between 5 to 7 days after establishment on various basal media supplemented with different types and concentrations of hormones. The presence of plant growth regulators is essential for callus formation in this plant, as the cultured explants in control treatments without hormones did not produce any calli. Callus formation was observed in all media and hormonal treatments, but produced calli were different from each other in terms of size, color and texture. Our study showed that texture of calli was compact or friable. The texture of calli in DKW was the most compact with the least amount of cytokinin at any concentration of auxin. However, in MS, it was the most friable with the highest amount of cytokinin at any concentration of auxin. Also, in this medium, the texture of calli was the most friable with the highest concentration of auxin. The color of calli in hormonal treatments present in MS culture medium was white and light cream, but in most hormonal treatments in DKW culture medium, it was white. The results of this study indicate that the best medium was MS medium supplemented with 2 (µmol/l) 2,4-D with 2.5 (µmol/l) BA (friable callus). Furthermore, the most inappropriate medium for callus formation from cannabis leaves in terms of all the characteristics examined was the DKW culture medium along with 5 (µmol/l) 2,4-D in combination with 2.5 (µmol/l) BA. The compression of calli can be caused by the reduction of proliferation in the cells that are dividing, this reaction can be influenced by the auxin inside the explant. Adding high auxin to endogenous auxin, in addition to adding cytokinin with a low concentration can affect the formation of compact texture. The formation of friable callus requires a balanced combination of auxin and cytokinin. Another important factor in plant tissue culture is the color of the calli, which is a sign of tissue health and vitality. For example, a healthy calli under light conditions is usually green in color, but a dark brown or black color is usually a sign of the death of the calli, which is due to pollution, stress or the production of substances such as phenols. Maximizing callus formation in the shortest possible time is one of the important objectives in tissue culture techniques, which not only saves time and cost but also prevents possible somaclonal variations. In general, according to the results, one of the suitable mediums for callus production in cannabis is the DKW,so the results of this study confirm the introduction of  DKW as the best culture medium in past studies. However, the MS culture medium is also the best medium in the available study and the least suitable result of this study is related to one of the hormonal combinations in the DKW culture medium. This difference with the mentioned study may be due to differences in genotype, laboratory materials, hormone amount, vitamins or other conditions affecting the tissue culture of this plant.

 Calli provides the opportunity to reproduce plants on a large scale and produce disease-free plants. Generally according to the plant, friable calli have a more suitable tissue for somatic embryogenesis and suspension culture, whereas compact calli have a higher potential for regeneration. This medium is recommended for future studies on somatic embryogenesis and cell suspension cultures due to the calli being friable in it. 

The present study was conducted to study the effect of different concentrations of Bacillus subtilis on morphophysiological traits of flowers and coriander in two saffron ecotypes in order to determine the appropriate concentration of bacteria.

A factorial experiment was conducted in a randomized complete block design with three replications in the research farm of Zanjan University. Experimental treatments: the first factor of five levels of different concentrations of bacteria(zero, 102, 105, 106, 108 ) and the second factor consisting of two ecotypes (Natanz, Zanjan) were considered.

Different concentrations of bacteria showed a significant effect on all morphophysiological traits measured. The main effect of ecotype also showed a significant effect on the traits at the level of one and five percent, except for the fresh weight traits of stigma, chlorophyll. Based on the results of analysis of variance, bilateral interaction (year × ecotype, ecotype × bacterium) and tripartite interaction (bacterium × year × ecotype) on flower yield and phosphorus content of saffron leaves were significant. Among the ecotypes, Natanz ecotype showed more than Zanjan ecotype in fresh and dry weight of pistachio and its diameter (16.29, 10.99 g and 19.71 mm, respectively).

Considering the effects of Bacillus subtilis on saffron ecotypes, it can be concluded that saffron ecotypes showed different reactions to biofertilizer due to their differences and different growth characteristics. According to the results, the greatest effect of Bacillus subtilis on morphophysiological traits was observed at a concentration of 108 cfu / ml.

Cultivated saffron (Crocus sativus L.) boasts remarkable commercial value due to its possessing three pivotal metabolites: crocin, picrocrocin, and safranal. The significance of obtaining these metabolites, particularly crocin, from sources other than cultivated saffron has grown substantially, primarily driven by native wild saffron species in Iran. In this ongoing study, High-Performance Liquid Chromatography (HPLC) has been harnessed as a potent analytical tool for the identification of these metabolites in two wild saffron species, Khazar (C. caspius) and Ziba (C. specious), alongside the cultivated variety. Furthermore, bioinformatics tools have been employed to extract nucleotide and protein sequences, thereby facilitating the prediction of protein structures for genes integral to the biosynthesis process of these notable apocarotenoids in an in-silico manner. The research findings have showcased the presence of crocin across all analyzed samples, albeit in varying quantities. Specifically, the crocin content in the cultivated saffron, Ziba, and Khazar species accounted for 26.76%, 2.8%, and 0.74% of dry weight matter, respectively. However, the amount of picrocrocin and safranal metabolites in cultivated species was 8.4 and 0.03 percent, respectively, but there were no detectable amounts of these apocarotenoids in the studied wild species. , The existence of crocin in wild species has made hope for conducting research and searching in wild species for these effective substances and implementing breeding programs or genetic manipulation for the mentioned species.

Agricultural saffron Crocus sativus L. is a medicinal, widely used and expensive plant and has important effective substances: crocin, picrocrocin and safranal, which gives it the characteristics of color, taste and smell. The search for new sources producing the aforementioned apocarotenoids makes the importance of research on it more obvious day by day. Since the country of Iran has diploid wild species with characteristics close to the sterile triploid cultivated species, in the present research, two species of Caspian saffron C. caspius and Zeiba C. Speciosus, along with the cultivated species, were investigated and 6 genes active in the production of the three mentioned effective substances , CCD2, ALDH, PSY, LCY, BCH, UGT74 (and a housekeeping gene TUB as an internal control gene with constant expression in all tissues) in two flower tissues, stigma and perianth (tepal) and in five stages (time) of flowering including: The stages of bud formation (immature bud), bud ready to bloom, newly opened flower, mature flower and old flower were investigated. Using of Real Time PCR, the expression ratio (fold change) to the internal control gene (with logarithm based on 2) was investigated in different genes and different and sometimes similar expression patterns were observed with the gene expression in the cultivated species in both the stigma and stigma tissues. Based on the results obtained in this study and the increase or decrease in the expression of some genes involved in the pathways of apocarotenoids production, at the same time as the growth of the stages from the bud to the senescence stage of the flower, it is expected from the three aforementioned substances or from other apocarotenoids in the metabolom of flowers, cases have been found in the non-triploid species and create approaches for the commercial use of Iranian wild saffron species and pave the way for its commercialization.

Cannabis (Cannabis sativa L.) is an herbaceous annual plant belongs to Cannabacea Family. (Ahmad et al., 2008). The resistance to water shortage, the ability to grow in different climatic conditions, and great genetic diversity are features of this plant (Amaducci et al., 2008). Drought is one of the most important environmental stresses limiting crop production worldwide and has adverse effects on plant growth, development, which may result in decreased chlorophyll a and b and increased proline content of leaf (Lum et al., 2014; Karimi et al., 2016). Plants generally adapt to drought stress by inducing a variety of physiological, biochemical, and morphological responses, and each of these factors can be effective in introducing drought tolerant cultivars. Among the physiological properties, leaf water condition, membrane stability, photosynthetic changes and related factors are of great importance (Farooq et al., 2009). Considering the pharmaceutical and industrial importance of cannabis, this study was conducted to identify the drought tolerant and sensitive ecotypes of cannabis based on physiological responses.

This study was done in research greenhouse of University of Tehran, Iran, from February to July 2017 on the base of factorial experiment in as a completely randomized design (CRD) with three replications. The first factor consisted of three soil moisture levels [100% (normal irrigation), 75% (mild drought stress), and 50% (serve drought stress)] of field capacity (FC). Also, the 12 Iranian ecotypes of cannabis were the second factor where collected from different geographical regions of Iran including Urmia, Tabriz, Sanandaj, Dasht-e-Moghan, Rasht, Khomein, Daran, Qom, Shahrood, Kerman, Tabas, and Saravan. The seedlings thinning was done at 3-4 leaf pairs stage and four plants were maintained in each pot. At the time point of sex determination of plants, one female plant was kept for future study. The irrigation was done uniformly to all pots until the emergence of fifth pair of leaves and afterwards, irrigation treatments were applied. During applying irrigation treatments, the soil humidity of the pots was measured before each irrigation cycle. Relative water content, electrolyte leakage, chlorophyll a, chlorophyll b, total chlorophyll content and carotenoid pigments, proline content, catalase and guaiacol peroxidase enzymes were measured at full flowering period - early fruiting. The analyses of variance of obtained data were down using SAS software (v.9.2) and Duncan's multiple ranges test was used for comparing the averages at the significance level of α = 0.05.

The results showed that the highest value of relative water content was obtained from the normal irrigation, which was 77.21% and was reduced to 16.70 and 31.13% under mild and serve drought stress, respectively. Interaction effect of Irrigation levels and ecotypes showed that Urmia ecotype had the highest value of relative water content in normal irrigation treatment, and Tabriz ecotype had lowest value of this parameter in severe drought stress. The electrolyte leakage Index was decreased by 10.54 and 24.11% at mild and severe drought stress, compared to normal irrigation, respectively. The highest value of electrolyte leakage was obtained from Tabriz ecotype in severe drought stress, and the lowest value of this parameter was obtained from Tabas and Saravan ecotypes in normal irrigation treatment. The highest values of chlorophyll b and total chlorophyll content were obtained for Tabas and Urmia ecotypes with 0.61 and 2.25 (mg.g-1 fw), respectively, at normal irrigation treatment. The lowest values of this parameters were obtained for Tabriz and Dasht-e-Moghan ecotypes with 0.17 and 0.84 (mg.g-1 fw), respectively, in severe drought stress. Water deficit decreased 28.12% of carotenoid pigments at severe drought stress compared to normal irrigation, and it increased values of proline, catalase and guaiacol peroxidase enzymes with 47.06, 29.18 and 22.78 (%) respectively, at severe drought stress compared to normal condition. The highest values of carotenoid pigments, proline, catalase and guaiacol peroxidase enzymes were observed in the ecotypes of Tabas, Urmia, Qom and Urmia [0.79 (mg.g-1 fw), 1.27 (mg.g-1fw), 0.0820 and 0.5800(Mc.min-1 mg-1 pro), respectively], and the lowest values of them were obtained for Tabriz, Dasht-e-Moghan, Khomein and Rasht ecotypes [0.34 (mg.g-1fw),0.48 (mg.g-1 fw), 0.0396 and 0.2744 (Mc.min-1 mg-1 pro), respectively].

The results of this study showed that Tabas ecotype had a significant advantage in maintaining relative water content, maintaining chlorophyll content and maintaining membrane stability. The Tabriz Ecotype is the most sensitive ecotype for drought conditions. Because it lost the most values of the relative water content, chlorophyll content and membrane stability in stress condition compared to other ecotypes. Therefore, it can be concluded that the physiological parameters measured under drought stress conditions can be used as a criterion for the identification of tolerant and sensitive ecotypes.

Effect of Bacillus subtilis (0, 102, 105, 106, 108 cfu/ml) was studied on saffron (Crocus sativus L.) ecotypes Natanz and Zanjan during 2017-2019 via a factorial experiment based on randomized complete blocks design in three replicates. Number of leaves per corm, average length of leaves, flowers, petals and sepals, stigma fresh and dry weights, fresh and dry flower yield, number of flowers per plot, total phenol and anthocyanin in petals and the amount of nitrogen, phosphorus and potassium were measured. All morphophysiological were significantly affected due to B. subtilis treatment. The highest and the lowest fresh and dry weight of stigma was observed in 108 cfu/ml (41.44 mg and 7.13 mg) and no treated samples (32.91 mg and 6.14 mg), respectively. The maximum stigma fresh and dry weight was observed in Natanz ecotype. The highest amount of nitrogen, phosphorus and potassium was recorded in 108 cfu / ml (5.55 %, 2061ppm 66.75 and 7540.8 ppm, respectively) and the lowest in control (3.25 %, 1314.42 ppm and 4339.8 ppm, respectively). The highest amount of nitrogen and phosphorus was observed in Zanjan ecotype. According to the results, utilizing the B. bacteria in a proper concentration as a bio fertilizer can be considered beneficial towards optimal growth indices in saffron.

Raspberry (Rubus idaeus L.) is most important small fruits in the world with a good color and taste. The potential for optimum off-season production under greenhouse conditions improved its commercial value. In-vitro tissue culture is one of the methods for large-scale and uniform propagation of raspberries, where the type and concentration of employed growth regulators are crucial to complement and accelerate growth. Therefore, the aim of this study was to investigate the effect of different concentrations of benzyladenine and indolebutyric acid on direct regeneration of the raspberry lateral bud.

Red raspberry bushes cv. September were used for this experiment. The experiment was carried out a factorial experiment in a completely randomized design with four replications and each replication with five explants at Sari University of Agricultural Sciences and Natural Resources. Uniform lateral bud explants after disinfection placed in culture medium containing benzyladenine at three levels of 0, 0.4 and 1 mg L-1 and indolebutyric acid at three levels of 0, 0.1 and 0.5 mg L-1 in controlled environmental conditions and finally traits such as leaf number, node number, root number, root length and ect as well as photosynthetic pigments were measured.

The results of this study showed that simultaneous use of different concentrations of benzyladenine and indolebutyric acid growth regulators in the culture medium of raspberry explants had a positive effect on a number of studied traits. The use of high concentrations of benzyladenine increased traits such as leaf number, number of node, number of internode, leaf length, lamina length. Also, the use of benzyladenine with high concentrations of indolebutyric acid increased explant size and petiole diameter. Examination of explant root length and number showed that increasing benzyl adenine concentration decreased these traits, but the use of indolebutyric acid at higher levels increased root length and number. Evaluation of the effect Results of benzyladenine and indolebutyric acid on photosynthetic pigments indicated that the increase of these regulators increased chlorophyll a, chlorophyll b and carotenoid in traeted explants.

In general, the use of benzyladenine plus indolebutyric acid was effective depending on the concentration used, was effective in improving the vegetative traits of the plantlets of the raspberry lateral bud explants, but indolebutyric acid alone only affected rooting at high concentrations. So that the use of indolebutyric acid increased root number and length at higher levels that suggesting a functional contrast between these two growth regulators. Investigating the effect results of benzyladenine and indolebutyric acid on photosynthetic pigments resolved the ambiguity of how enhancing these regulators led to synergized and improved explant size. It was observed that with increasing concentrations of these regulators, increased in important photosynthetic pigments such as chlorophyll a, chlorophyll b and carotenoid was obvious. Importantly, the tissue and organs of raspberries are more susceptible than black berry and respond to lower concentrations of this growth regulators.

The present study has been conducted to investigate the duration of growth period of different cannabis (Cannabis sativa L.) ecotypes and their responses to water stress based on a factorial completely randomized experiment design in the greenhouse condition at the University of Tehran in 2017. Irrigation levels include 50%, 75%, and 100% of field capacity, with the ecotypes being Urmia, Sanandaj, Tabriz, Dasht-e-Moghan, Rasht, Khomein, Daran, Qom, Shahroud, Kerman, Tabas, and Saravan. Results show that Rasht and Khomein ecotypes have had the highest and lowest duration of germination phase and growth degree-days (GDD1), respectively. The highest duration of vegetative, flowering and maturation phases belong to Dasht-e-Moghan, Rasht, and Dasht-e-Moghan ecotypes with 71.33, 30, and 46.66 (days), respectively, at 100% field capacity. The lowest durations of these phases could be seen in Tabas, Tabriz, and Saravan ecotypes with 42, 16, and 17 (days), respectively, at 50% field capacity. Also, the highest values of growth degree-days for vegetative (GDD2), flowering (GDD3), and maturation (GDD4) phases  for Dasht-e-Moghan, Kerman, and Dasht-e-Moghan ecotypes with 1788, 836, and 1169 (0C.d), respectively, at 100% field capacity, with their lowest values belonging to Tabas, Tabri,z and Saravan with 1039, 413, and 448 (0C.d), respectively, at 50% field capacity. Based on growth period duration and cumulative growth degree-days (total GDD), Tabas and Dasht-e-Moghan ecotypes are found as earliest and latest ecotypes, respectively.

Drought stress is one of the most important environmental factors, which limit the growth of plants. By the end of the 21st century, the incidence of drought stress is expected to increase because of the global warming phenomenon. As a consequence, trees growth and viability in the forests and urban greenspace will reduce. Thus, selection of plants that are more tolerant to severe drought stress and are able to cope with such environmental conditions needs to be considered in future silvicultural strategies. This study was carried out to identify candidate drought-tolerance proteins in Maclura pomifera. Therefore, we aimed to explore the performance of Maclura pomifera under a severe drought stress and analyse the proteome changes of Maclura pomifera leaf in response to drought.

The experiment was carried out on 4-year-old Maclura pomifera saplings genotypes cultivated on a flat field in the Botanical Garden of University of Tehran. Saplings were exposed to irrigation regimes of 100% and 25% field capacity in a completely randomized design. Leaf samples were collected and were frozen immediately in liquid nitrogen and then stored at −80◦C to be used for further analyses. Experiments were performed using the gradient pH 3-10 NL IPG strips for the isoelectric focusing. IEF was carried out using the PROTEAN IEF. Strips were then equilibrated first for 15 min in reducing solution and then 15 min in alkylating solution. Equilibrated IPG strips were then placed and fixed using hot agarose on the top of home-made 12 % SDS- polyacrylamide gels. Separation of proteins in the second dimension was carried out in Protean XL cell. The protein spots were visualized by staining with BioSafe Coomassie gel stains following manufacturer’s instructions.

After doing two-dimensional gel electrophoresis, 25 protein spots that had displayed significant protein level changes were identified. Differentially expressed, proteins were divided in three groups. The first group included stress and defense proteins such as lipoxygenase, two types of heat shock protein, Allergen, Convicilin and legumin A2 precursorm; the second group included oxidative stress proteins such as Catalase, Chloroplast stromal ascorbate Peroxidase, Cytosolic ascorbate peroxidase, Iron superoxide dismutase and Manganese superoxide dismutase. Thethird group included energy and metabolism proteins such as Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, Ribulose -1,5- bisphosphate carboxylase /oxygenase small subuni, Translation elongation factor, Aldolase, Hydroxy-acid oxidase, Isopentenyl diphosphate isomerase, Dihydrolipoamide dehydrogenase and glyoxalase. The present results indicate that most proteins have been identified and their changes caused an increase in tolerance and adaptation of Maclura pomifera to drought stress. Also, our data suggest that drought tolerance of M. pomifera might be correlated with diminishing oxidative damage by activation of the antioxidant systems.

The present results indicate that most proteins have been identified and their changes caused an increase in tolerance and adaptation of Maclura pomifera to drought stress. Also, our data suggest that drought tolerance of M. pomifera might be correlated with diminishing oxidative damage by activation of the antioxidant systems.

Rosmarinic acid (RA) is a well known valuable phenolic compound because of its wide spectrum of biological activities such as antimicrobial, anti-inflammatory, antimutagenic, antioxidant and cancer chemoprevention. In the present study, in vitro callus induction and production of RA in Salvia nemorosa (callus culture, in vitro seedling, mother plant) have been studied. For this purpose, callus induction was achieved from young leaf explants cultured on MS medium supplemented with different concentrations of 2,4-D (0, 0.5, 1, 2 and 5 mgL-1) solely or in combination with BAP and Kin (0.5, 1 and 2 mgL-1) and the number of different traits such as percentage of callus induction, fresh weight and type of callus (texture and color) were evaluated. The highest percentage of callus induction was achieved from 3 treatment supplemented by 5 mgL-1 2,4-D+ 2 mgL-1 BAP, 1 mgL-1 2,4-D + 1 mgL-1 BAP and 2 mgL-1 2,4-D + 2 mgL-1 Kin. Also The best fresh weight (1.31g) were obtained in MS medium containing 1 mgL-1 BAP and 1 mgL-1 2,4-D. According to the result the callus has the highest RA content with a value of 1.5 mg gdw-1 and RA accumulate in callus to amounts (2 fold) much higher than plants under field conditions. According our findings the callus culture of Salvia nemorosa L. on MS medium containing 1 mgL-1 BAP and 1 mgL-1 2,4-D provided useful method for RA production.

Salvia leriifolia Benth. is one of the native Iranian medicinal plants which has been received attention in recent years due to its numerous therapeutic properties. The pharmaceutical properties of this species have been attributed to the presence of phenolic compounds, especially phenolic acids. The present study investigated the effect of plant age (phenology) on the gene expression and activity of phenolic acid-biosynthetic enzymes. Plant seeds were collected from Torbat-e-Heydariyeh (Khorasan Razavi province, Iran) and planted under greenhouse conditions. Leaves were sampled at 8-, 16- and 24-leaf stages of the growth period. Total contents of phenols, flavonoids, and phenolic acids were measured using spectrophotometry, and the phenolic acid profile was determined by high-performance liquid chromatography (HPLC). The activities of phenylalanine ammonia-lyase (PAL) and tyrosine aminotransferase (TAT) were measured by spectrophotometry, and the activity of rosmarinic acid synthase (RAS) was evaluated by HPLC. The relative expression of the corresponding genes was quantified by RT-PCR. The results showed that the content of all phenolic compounds and the activities of TAT and RAS enzymes/genes increased significantly (p < /em>≤0.05) with increasing plant age. At the 24-leaf stage, the total content of phenols, flavonoids, and phenolic acids were 3.47-, 2.80-, and 7.78-fold of those measured at the 8-leaf stage, respectively. The concentration of rosmarinic acid and caffeic acid (0.69 and 0.36 mg/g DW at the 8-leaf stage, respectively) increased by 3.41- and 4.05-fold during the vegetative growth, respectively. Lithospermic acid and salvianolic acids had a smaller share of total phenolic acids (0.01-0.06 mg/g DW at the 8-leaf stage), and their contents increased 2- to 10-fold with increasing plant age. Also, a strong positive correlation was observed between plant age and phenolic acid accumulation and between plant age and the activity and gene expression of TAT and RAS. TAT enzyme might play the main role in the biosynthesis of rosmarinic acid compared to PAL.

Fire blight, the most important disease of pear tree causes necrosis by an oxidative stress in tissues. Therefore, identification of resistant cultivars and mechanisms of resistance to the oxidative stress of disease, that are mainly related to the chloroplasts, are important in breeding programs of this tree.  In order to study the role of chloroplasts in this interaction, expression of chloroplastic gene psbA that are under control of oxidation/reduction (redox), was evaluated in susceptible (Williams) and resistant (Harrow Sweet) cultivars during 48 h post inoculation by Erwinia amylovora in in vitro condition. In addition, expression of this gene was studied at presence of glutaraldehyde and rotenone as the inhibitors of the electron transport chain of chloroplast and mitochondria, respectively. The results showed higher necrosis progress rate in the in vitroshootlets of susceptible cultivar. Expression of psbA gene at presence of inhibitors in both presence and absence of E. amylovora was higher in cultivars Harrow Sweet. According to the results, the higher resistance level of cultivars Harrow Sweet to the disease could be due to the higher rapid responses and reaction of the chloroplasts of this cultivar in comparison to the cultivar Williams.

Nowadays, soil contamination with heavy metals is one of the major environmental concerns. Among heavy metals, lead is one of the main concerns due to its effects on human health and environment. The most important sources of this pollution in most parts of the world are mines, industrial waste, chemical fertilizers and pesticides. In order to investigate the adsorption capacity of lead by the ornamental plant of viola (Viola tricolor) and to find the morphological and physiological responses of plant against lead stress, a study in contaminated soil with different levels of lead (0, 200 and 400 mg/kg) was done in a completely randomized design with five repetitions in the greenhouse of the Faculty of Agriculture, University of Tehran. The results showed by increasing the concentration of lead in the soil, its amount increased in three parts of shoots, roots and flowers of the plant and the highest accumulation of lead in the roots was found to be 41.27 mg/kg. The high lead pollution reduced the fresh and dry weight of shoots and roots and the root length as compared to the control. Also, total antioxidants and glycine betaine as a defensive factor against stress were found at a concentration of 400 mg/kg lead, which were 61.3% and 114.33 μmol/g, respectively. Therefore, violet can be recommended as an adsorbent of lead and a stress reliever in urban and industrial green space cultivation.

Grapes with the scientific name (Vitis vinifera L.) belong to the Vitaceae family. Detection, selection and use of grape varieties with drought stress is one of the most important issues in breeding programs and grape production. Therefore, identification, studying and evaluation of physiological and morphological reactions of Iranian grape varieties under drought stress is of great importance in grapevine research. Considering the dispersal of most of Iran's grapes in arid and semi-arid regions, as well as the cultivation of this plant in rainfed form in some provinces of the country such as Kurdistan, Fars, etc., grape plants in part of their annual growth That is, during the summer when excessive evapotranspiration is strongly affected by drought stress and water scarcity, causing problems such as shortening the growth period, reducing flowering and physiological aging and ultimately leading to reduced yield and The plant disappears. To investigate the effect of soil water potential changes on some physiological and biochemical of grape seedlings, an experiment carry out as factorial arranged in a randomized complete block design with three replications with three cultivar including ‘Bidane sefid’, ‘Chafte’ and ‘Yaghooti’ and four drought stress level including -0.3, -0.6, -1 and -1.5 MP soil water potential. After planting seedlings in pots, and reching soil water potential to target level, Electrolyte leakage, malondialdehyde (MDA) content, Lipoxygenase (LOX) enzyme activity, phenylalanine ammonia lyase (PAL) enzyme activity, polyphenol oxidase (PPO) enzyme activities and total phenols accumulation levels were measured in leaves. The results showed that under -1.5 MP soil water potentials ‘Bidane sefid’ had highest levels of electrolyte leakage (31.63%) but ‘Chafte’ and ‘Yaghooti’ had the lowest electrolyte leakage, 24.10 and 25.88 %, respectively. The activity of PAL enzyme under -1 and -1.5 MP soil water potentials in ‘Chafte’ and ‘Yaghooti’ was increased significantly, (under -1.5 MP soil water potentials exhibited highest enzyme activity, 2.45 and 1.97 µmol cinnamic acid. h-1, respectively). However under drought stress levels from -0.3 to -1.5 MP soil water potentials, ‘Bidane sefid’ cultivar had not significantly change in PAL enzyme activity. Under -1.5 MP soil water potentials, ‘Bidane sefid’ exhibited highest PPO enzyme activity (2.78 U.mg-1 protein), but ‘Chafte’ has not significantly change in their PPO enzyme activity. In the ‘Yaghooti’, PPO enzyme activity significantly increased from levels -0.6 to -1 MP soil water potentials. Our results indicated that the ‘Chafte’ under -1.5 Mpa and ‘Yaghooti’ under -1 Mp cultivars had higher tolerance to drought conditions as compared with ‘Bidane sefid’.

In order to use alternative sources of fiber such as hemp to supply the paper and wood fiber, the exploration and utilization of abundant hemp variations seems to be necessary. In this study, some hemp populations collected from different part of Iran were evaluated with reference to wood anatomy and fiber biometry characteristics. Vessel characteristics of stems including average vessel lumen area, vessel density and porosity were measured using cross-sectioned tissues of stems. Fiber biometry characteristics of fibers including fiber length, fiber width, fiber cell wall thickness and fiber lumen width were measured and compared using macerated bast and core fibers. In conclusion based on vessel characteristics, Frs, San 02, Mahb, Zah and Mahl, populations, are expected to be putative high potential fiber populations, due to having the least vessel density and porosity leading to more woody core fiber content. Regarding fiber length, populations of Ban, Bsh, Frs and Kash, Bsh and Nhv, showed higher average for bast and woody cores, respectively. Hence these populations are expected to perform better in properties related to fiber length such as textile and paper strength and can be successfully used in paper making, fiberboard and textile industries as well as being used in selective breeding programs. Also all populations were evaluated based on their bast and wood fiber width, fiber cell wall thickness and fiber lumen width as effective factors on final product properties.

Cannabis (Cannabis sativa L.), commonly known as hemp, is an annual herb belongs to the family Cannabacea. The seeds of this plant have considerable content of oil and unsaturated fatty acids, and its fiber is used in the paper and textile industries. Tetrahydrocannabinol and cannabidiol are main cannabinoid compounds of this plant, which have high importance for their well-known pharmaceutical properties. Therapeutic effects of secondary metabolites of hemp on different diseases, such as cancer, Multiple Sclerosis (M.S.), and AIDS and their anxiety and palliative characteristics have been reported in several studies. Considering oil content, and therapeutic and industrial properties of the hemp as well as, its high diversity in Iran, more studies are needed to better recognize this plant and the economic production of its therapeutic compounds. In the present paper, a comprehensive review of agronomic, therapeutic and phytochemical characteristics of hemp is presented.

Cannabis sativa L. is an important plant with various uses in pharmaceutical and paper production industries. Due to the higher priority of female and male Cannabis plants for pharmaceutical uses and fibre industry, respectively, reduction of the quality of products after pollination, and also for detection of better genotypes before pollination for breeding purposes, early determination of sex in Cannabis is one of the major concerns of researchers and farmers. Seeds of 26 accessions from different regions of Iran along with one accession from Afghanistan were planted in the field based on randomized complete block design with 10 replications. Five female and five male plants were sampled from each accession for molecular and morphological analyses. Thirteen ISSR primers and two SCAR markers were used. Also, morphological differences, which possibly related to sex were measured in the Cannabis populations under study. The results showed significant differences among the accessions within female and male plants for plant height, number of days to flowering, days after full bloom and height of the first flowering node. Male plants were generally, but not always, taller than female plants and had a shorter life cycle. The highest expected heterozygosity was found in the ISSR3 primer and the lowest in the UBC825 primer. In total, 143 polymorphic bands and one polymorphic band were amplified using ISSR and SCAR primers, respectively. Out of 143 polymorphic ISSR bands, only 10 markers had significant relations with the gender of this plant. MADC6 SCAR marker was monomorph across the accessions. On the other hand, MADC5 was a polymorphic marker and showed a significant relation with gender. These markers, especially MADC5, have the potential to be used in sex determination of C. sativa.

In order to achieve maximum proliferation in culture media, different amounts of salts and growth regulators could be used regarding to plant species. Sometimes, interaction effects of these materials could results in different results on explant’s proliferation in vitro condition. In the present study the effect of two basic culture media including MS and QL on Micro propagation of Pyrus betulifolia (pear vigorous rootstock) were studied. The highest amount of proliferation was achieved in QL culture medium and highest amount leaf expansion was in MS culture medium. In order to produce more leaf expansion in QL culture medium and as for existence of difference in ions pure amount including NO3-, NH4+, Cl-and Ca2+ in two culture media, NH4NO3 in three concentrations including 6.25, 12.5 and 18.75 mM and CaCl2 in two concentrations including 0.9 and 1.8 mM were added to QL culture medium. As for the result, increasing NH4NO3 and CaCl2 amounts had no effect on proliferation of explants but by increasing NH4NO3 and CaCl2 leaf expansion increased in QL culture medium. In the other experiment for increasing of proliferation rate in MS culture medium, by increasing BAP amount, from 0.5 to 2 mg/l in MS culture medium, proliferation in this medium was increased. Apparently in MS culture medium with more concentration of macro elements compared to QL culture medium, it needs to use more growth regulators for achieving suitable proliferation. Totally, Results of this study showed that to succeed micro propagation of Pyrus betulifolia in both two basic culture media requires suitable concentrations of BAP, NH4NO3 and CaCl2.

 The cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a significant agricultural pest in arable lands and on ornamental crops in temperate regions of the world and has been shown to be capable of developing resistance to many classes of insecticides. Difficulties in controlling B. tabaci mainly result from its resistance to insecticides, including neonicotinoids. Neonicotinoids are a relatively new class of synthetic insecticides used primarily to control of whiteflies, B. tabaci is capable of developing resistance to different classes of insecticides as neonicotinoides. It has been experimentally proven that resistance of B. tabaci to imidacloprid is associated with overexpression of the P450 genes. RNA interference (RNAi) has been successfully applied in insects to study RNAi mechanisms and gene functions. In this study, the RNA interference (RNAi) effects of P450 CYP6CM1 as key gene in resistance to neonicotinoides on expression, resistance ratio and total P450 activities were evaluated. Colony of whitefly reared on leaves of tomato plants in growth chamber at 25 ± 2 ºC, 65±5% RH and a photoperiod 16:8 h (light: darkness). Total RNA was isolated from adult B. tabaci using Biosol reagent (Invitrogen). cDNA synthesis was performed using iScript cDNA Synthesis Kit (BIO-RAD). Double-stranded RNA (dsRNA) of P450 CYP6CM1 was synthesized using specific primers (3' TAATACGACTCACTATAGGG 5', 3' TAATACGACTCACTATAGGG 5'), the bioassay tests after introduce of dsRNA into the insect body of whitefly by oral delivery were carried out for 6 days, and mortality was recorded daily by counting the dead insects at the bottom of the tube. The LC50 and resistance ratio were calculated using Ploplus computer software. The amount of cytochrome P450 activity was measured using 7-ethoxycoumarin based on the microfluorimetric method. Quantification of mRNA expression levels was quantified using the comparative cross-threshold (CT) (the PCR cycle number that crosses the signal threshold) method. Analysis of knockdown effects of CYP6CM1 on resistance was based on probit analysis and indicates that the gene is responsible for up to 5.3-fold reduction in imidacloprid resistance of dsRNA-fed adults. Moderate, but significant reduction in total P450 activity (45 %) exhibited by microsomal proteins prepared from dsRNA-fed JR population adult when compared to the control (JR population without dsRNA-fed). The results of P450 CYP6CM1 mRNA expression levels showed decrease in mRNA levels of the target genes with increasing the time after feeding dsRNA. Results revealed that delivery dsRNA to adult insect's reduced CYP6CM1 expression up to 2 -fold when comparing to the control. Reduction in resistance ratio by 5.3 fold after CYP6CM1 dsRNA fed in resistance population indicated the possibility of practical use of RNAi technique in insect resistance management (IRM).

Saffron (Crocus sativus L.) belonging to Iridaceae family as a source of apocarotenoids is one of the most valuable spices and medicinal plants in the world. Because of the large size and high complexity of saffron genome, its sequencing remains a challenge. The arrival of next-generation sequencing technologies (NGS) has allowed the rapid and efficient development for RNA sequencing. De novo assembly of transcriptome from short-read RNA-Seq data provides a great resource for the study of species without a reference genome. De novo assembly of the transcriptome has some unique challenges, particularly in the case of plants, which possess a large amount of paralogs, orthologs, homoeologs and isoforms. In this research, we attempted to compare the performance of de novo assembly tools including BinPacker, Bridger, Oases-Velvet and Trinity through consideration of a quality metrics such as N50 length, the total number of contigs and alignment scores. The results of these analyses revealed that assembly using Bridger had a superior performance for saffron transcriptome, Oases suffered from relatively high chimera rates and redundancies which causes genes family with high similarity assembled into one transcript, Trinity performs worse than Bridger in the increase of false positives. Our comparison study will assist researchers in selecting a well-suited assembler and offer essential information for the improvement of existing assemblers.

Medicinal Plants are almost reach sources of natural antioxidants such as terpenoids and phenolic compounds and have great potential as an alternative for synthetic antioxidants against oxidative stresses. Peppermint (Mentha piperita) infusion is a valuable worldwide source of antioxidants. The antioxidant property can be enhanced by inducing abiotic stresses. This experiment was conducted to evaluate prolong (4 months) water deficit stress (no stress, mild stress and severe stress as 100, 75 and 50% of field capacity, respectively) on cultivated peppermint on plant growth, secondary metabolite profile and antioxidant capacity of peppermint infusions. Both water deficit stress treatment decresed plant height, leaf wet and dry weight and leaf size significantly. Also, water deficit stress increased antioxidant capacity, total phenolic and flavonoid contents significantly. Some phenolic compounds such as quercetin, coumaric acid and luteolin were detected only in water-deficit conditions. Also, the amount of some identified amino acids and unsaturated fatty acids were changed under water deficit stress. Therefore, inducing water stress can enhance the biological value of peppermint and improve bioactive compounds and the antioxidant capacity of peppermint extract.

Cannabis sativa L. is an important economic plant for the production of medical, food, fiber and oils. Nevertheless, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. In this study, transcriptome sequences were used for identification and introduction of SSR markers in order to assess genetic diversity and separation of fiber and drug types. Based on the cannabis RNA-Seq data, 3383 SSR were identified from 1402 reads in fiber type whiles this number was 10381 for 4743 reads in drug type. Among these markers, trinucleotide repeat motifs were the most abundant, followed by mononucleotide and dinucleotide. Primers were successfully designed for amplification of 234 SSR markers from 152 individual sequences in fiber and 1543 SSR markers from 1372 individual sequences in drug using Primer3 with default parameters. This study outlines the first large-scale development of SSR markers for cannabis. The effectiveness of these molecular markers should be tested using different Iranian Marijuana populations and could be particularly useful for cannabis populations breeding.

The clonal propagation of vigorous pear rootstocks is possible by micropropagation, but in this condition many of them demonstrate low proliferation rate and produce short in vitro shootlets. To improve quality of in vitro shootlets, the effects of NH4NO3 and CaCl2, were investigated in pear rootstocks, Q1 (Pyrus communis L.), P. betulifolia, Konjuni (P. communis×P. ussuriensis Rehd.) and Dargazi seedling as control on QL medium. This objective was followed by adding NH4NO3 in 6.25 (control QL medium), 12.5 and 18.75 mM, and CaCl2 in 0 (control QL medium), 0.9 and 1.8 mM and evaluation of proliferation, shootlets quality and percentage of N and Ca absorption by shootlets. P. betulifolia normally expressed high growth and low proliferation, while Q1 had moderately higher proliferation in comparison with other rootstocks. Increasing of NH4NO3 reduced the proliferation but CaCl2 increasing improved the leaf expansion. N and Ca absorption in all rootstocks were higher than threshold levels of these elements in this species and NH4NO3 addition increased N absorption for P. betulifolia, Q1, Konjuni and Dargazi seedling to 7.58, 4.31, 5.78 and 6.24%, respectively. Contrarily to N absorption, the highest Ca absorption was observed for three rootstock, P. betulifolia, Q1 and Konjuni in lowest CaCl2 concentration. The presence of highest Ca contents in the lowest NH4NO3 concentration shows the negative effects of this salt on Ca absorption in pear rootstocks.

Aberrant pre-mRNA alternative splicing is a common event in cancer cells. Many abnormally spliced RNA variants have been observed in tumor cells and they can be used as biomarkers or therapeutic targets in new drug design. Increasing our knowledge in understanding the mechanisms of alternative pre-mRNA splicing for cancer-related genes and determination of cancer specific isoforms are important for the development of new strategies in cancer therapy. The aim of this study was isoforms identification and expression of PIK3CA, FGFR3 and FGFR1 genes in bladder cancer by RNA Sequencing and Real-Time PCR.
This cross-sectional study was conducted at Urology Research Center of Sina Hospital, Tehran University of Medical Sciences, Tehran, from September 2014 to October 2016. Paired tumor and adjacent normal tissues samples were obtained from 30 bladder cancer subjects. Total RNAs were extracted from bladder tumor and normal tissues. Quantitative and qualitative examinations have been done. After quality control, fragmentation of RNAs and cDNA library construction, next-generation RNA sequencing was performed. Resulting raw data were analyzed with different bioinformatics software. Differential expression was confirmed by Real-Time PCR.
RNA sequencing results showed the number of PIK3CA (1 vs 3), FGFR3 (7 vs 6) and FGFR1 (9 vs 12) isoforms and their expression were different in bladder normal tissues in comparison to tumor tissues. Overexpression of PIK3CA gene have been observed in 42% of tumor samples but statistically was not significant. Increased FGFR3 gene (P=0.01) and decreased FGFR1 (P=0.01) expression were significant. There was an association with overexpression of FGFR3 and cigarette smoking ((P=0.037) and family history (P=0.004).
RNA sequencing make possible to do the accurate assessment of transcript abundance and identification of different isoforms resulted from aberrant pre-mRNA alternative splicing, which is a crucial process for the maturation of transcripts of multi-exon genes. Regarding the differences in isoforms expression in tumor and normal tissues of bladder cancer, they have potential to be used as biomarkers and sensitive targets for cancer therapy.

For improvement asymbiotic seed germination media of temperate terrestrial orchid Epipactis veratrifolia , 12 different concentrations of the carbohydrates (fructose, glucose, sucrose and two combination of fructose with sucrose ) were assessed on the seed germination and protocorm development, in the presence (2g L−1) and absence of peptone in Fast medium. Results revealed significant differences between treatments on seed germination percentage and protocorm growth. Carbohydrate treatments; H12 (3.5g/l fructose g/l sucrose), H8(10 g/l sucrose), H2 (20 g/l glucose), and H11 (5 g/l fructose g/l sucrose) had significant effect on seed germination percentage. H11and H12 was the best medium for protocorm growth. H8P2(10 g/l sucrose g/l peptone), H2P2(20 g/l glucose g/l peptone) and H12P2(3.5g/l fructose g/l sucrose g/l peptone) were the best for seed germination respectively with 79/6%, 74/6% and 71/9% seed germination percentage. H10P2 (30 sucrose g/l g/l peptone) with 17/3mm growth, significantly was the best for protocorm growth. Therefore kind and concentration of carbohydrate and presence of organic nitrogen (peptone) influence asymbiotic seed germination percentage and protocorm growth and could improved both of them. This finding revealing that it is possible to improvement asymbiotic seed germination of this species orchid with combination of mono and disaccharides and organic nitrogen.