محمد تقی بیگی نصیری

The sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy. To carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes. The result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation. Based on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.

In order to evaluate cytoplasmic inheritance of growth traits (including birth weight, 3, 6, 9 and 12 month weight), the total number of 19717 Arabic sheep records which was collected by Agricultural Organization of Khuzestan province was used during1989 to 2010. Following the cytoplasmic lines from progeny to the parents, cytoplasmic primary sources were identified. Environmental factors affecting these traits were analyzed by SAS statistical software. Genetic parameters were estimated using Bayesian statistical method and MTGSAM software. Significant effect (P <0.01) on traits including lambs sex, birth type, maternal age and birth year were found. Based on the lowest acacia criteria in Bayesian statistical method, models 5, 5, 3, 4, 3 for birth weight, 3, 6, 9 and 12 months were the best models respectively. The cytoplasmic inheritance for birth weight, 3 months of age was 0.02, 0.03, and for the weights at 6, 9 and 12 months age, there was no cytoplasmic inheritance. However, the observed cytoplasmic variance for birth weight and 3 months old weight in Arab sheep were 0.004, 0.410, respectively, while no cytoplasmic variance for 6 to 12 months old was observed. Generally, although for the weight trait the share of cytoplasmic inheritance was low, but considering maternal effects and cytoplasmic heritages would result in a more accurate estimation of the genetic parameters of the growth traits of all ages.

The purpose of this research was to determine the population structure and effective population size of Najdi, Holstein and their hybrids in the herds of Khuzestan province. For this purpose, the genomic information of 329 cattle samples including 141, 60 and 128 samples from Holstein, mixed and Najdi breeds were used. The samples were genotyped with Illumina SNP30K genomic arrays. Population analysis was done using PCA and plotNJ, and in both methods the populations were somewhat separated. The range of r2 is from 0.150 ± 0.359 in chromosome 26 to 0.244 ± 0.450 in chromosome 20 for the Holstein breed and 0.130 ± 0.319 in chromosome 28 to 0.271 ± 0.462 in chromosome 20 in were mixed livestock, while the highest value of r2 was observed in the Najdi breed from the range of 0.120 ± 0.311 in chromosome 28 to 0.271 ± 0.483 in chromosome 20. The effective size of the populations in the fifth generation for the populations of this study was 45 Najdi heads, 101 mixed heads and 110 Holstein heads. These numbers for Najdi cattle are far from the recommended values for the protection of populations, and this indicates a serious risk of eliminating native Najdi cattle in the near future. Reducing the effective size will increase the sensitivity of this population to the upcoming environmental changes.

This research was conducted to identify and validate the simple sequence repeats (SSR) markers related to yellowfin barbel (Luciobarbus xanthopterus) using RNA-Seq data. After collecting the liver tissue, RNA was extracted from the samples. The samples were sequenced using the Illumina Novaseq 6000 platform. Trinity software (version 2.15.1) was used to reconstruct transcripts. Identification of SSR was done using the MISA web server. The primers needed in the polymerase chain reaction for 5 SSR markers were designed by PRIMER 3 software and validated using 45 yellowfin barbel. Transcript assembly by the Trinity program generated 941,894 unigenes and 1,768,662 transcripts. In this study, the examination of 1,276,825 sequences by MISA software led to the identification of 349,871 potential SSR markers. Among the SSRs, di- and trinucleotide repeats had the highest number of repetitions with 89.37% and 8.05%, respectively. From the 5 primers used, only two of them showed polymorphism. The expected and observed heterozygosity for the MN1359 locus were calculated as 0.785 and 0.147, and for the GM1371 locus given 0.770 and 0.093, respectively. Moreover, the chi-square test showed that population was not in Hardy-Weinberg equilibrium. The results of different genetic diversity criteria showed a decrease in diversity in yellowfin barbel. Generally, this research showed that the new SSRs can be helpful for molecular breeding, functional genomics studies, and the genetic diversity analysis of yellowfin barbel.

The scorpion of Hemiscorpius lepturus is the deadliest scorpion in Iran, so it is very important from a medical point of view. Clinical symptoms caused by H. lepturus scorpion envenoming such as neurotoxic effects, skin burns, and some inflammatory reactions have been attributed to its phospholipase A2 activity. The aim of this study is to identify and categorize the genes encoding phospholipase A2 in H. lepturus scorpion venom gland. For this purpose, in this study, a cDNA library was produced from the venom glands of this scorpion using the Illumina RNA sequencing technique. The coding sequences of PLA2 were identified and extracted using the basic local alignment search tool (BLAST) and similarity searches between raw venom gland data with sequences recorded from other arthropods, especially the scorpion Centruroides sculpturatus. These searches led to the discovery of several homologs of PLA2 in the venom glands of this scorpion with sequence similarity to platelet acetylhydrolase-activating factor (PAFA), calcium-dependent PLA2s (cPLA2), secreted PLA2s (sPLA2), calcium-independent PLA2s (iPLA2) and, group III heterodimeric phospholipase A2 (hgPLA2). Most of the found sequences showed the most similarity with the PLA2 sequences from scorpions of C. sculpturatus and Androctonus crassicauda. This report is one of the few transcriptome sequencing efforts to identify, classify and analyze the physicochemical properties of PLA2 sequences form venom gland of H. lepturus, in which the phylogenetic relationships between different arthropods were investigated using the identified sequences of the genus Hemiscorpius.

Based on the RNA-seq method, a thorough set of information can be obtained from the identification of geneswhich the results  may be beneficial  in the genetics and breeding of livestock and poultry. So far, few studies have been reported regarding the use of this method in the evaluation of native poultry transcriptome. Considering the importance of lncRNAs in biological processes, the present study has investigated the lncRNAs from the transcriptome of native Isfahan  chicken and the commercial Ross 708 strain as well as differences  in their expression. In this study using next generation sequencing, 568 lncRNAs were identified, out of which the expression changes of 116 lncRNAs were meaningful (P-value ≤0.05). The results showed differently-expressed incRNAs which are associated with the biological pathways including histone and lysine methylation, myeloid leukocyte activation, positive regulation of cytokine production ,, , and regulation of lymphocyte activation. The analysis of molecular functions of the genes indicated the activity of non-membrane-spanning tyrosine kinase, protein methyltransferase, S-adenosylmethionine-dependent methyltransferase, and transfer of one-carbon groupsacting on a protein, and signaling receptor binding are enhanced meaningfully. Based on the results, lncRNAs that vary in expression between native and commercial groups are associated with immune and methylation pathways, and can be used as biomarkers.

Estrogen consumption in women can increase the risk of breast cancer. Estrogen stimulates the growth of cancer cells through the estrogen receptor alpha (ERα). One of the strategies that has recently been considered is the use of phytoestrogens. Previous studies have shown that Chaste-berry contains high levels of phytoestrogens. Scientists disagree on whether the phytoestrogens in Chaste-berry are used to treat many diseases in women, which are ERα or ERβ selective. In the present study, laying hens were used as a model to find the answer because only alpha estrogen receptor is expressed in the oviduct. In this study, the effect of Chaste-berry fruit powder on performance, egg quality, immune response, and the expression of GnRH, LH, ovalbumin (OVAL), and ovomucoid (OVM) genes in laying hens were evaluated. A total of 90 leghorns (Hy-Line, W-36) laying hens (at 72 to 80 weeks old) were used in a completely randomized design with three treatments and five replicates (n=6). The treatments were various levels of Chaste-berry fruit powder including zero, 1, and 2% levels of Chaste-berry fruit powder per kg of diet. Our results showed that performance parameters, egg quality factors, and immune responses were not significantly affected by various levels of Chaste-berry fruit powder. Moreover, the results indicated that the various levels of Chaste-berry did not have a significant effect on LH, OVAL, and OVM gene expression. However, GnRH gene expression was significantly increased in treatment 3 (a diet containing 2% Chaste-berry) compared to the control and 1% Chaste-berry groups. Moreover, the addition of 1% Chaste-berry fruit powder to the diet had no significant effect on GnRH gene expression. Therefore, Chaste-berry supplementation is not recommended in laying hens. Furthermore, our data reinforce this theory that phytoestrogens in Chaste-berry fruits are ERβ-selective.

Phytoestrogens are herbal estrogens with estrogen-like functions and structures. The estrogen hormone has an important role in the process of the synthesis of egg white proteins in the avian oviduct. Vitex agnus-castus (VAC) is a native plant of the middle Asian, southern European, and Mediterranean countries. This plant has numerous uses in traditional medicine and is traditionally used to treat many diseases in women. Previous studies have shown that VAC contains high levels of phytoestrogens. VAC consists of compounds such as vitexin, apigenin, and pendoltin, which are the most active phytoestrogen in VAC fruits. No study has been published so far on the effect of VAC on oviduct markers gene expression (ovalbumin (OVAL) and ovomucoid (OVM)). Hence, this study was performed to evaluate the effect of VAC fruits on gene expression for two oviduct markers OVAL and OVM of laying hens.

A total of 90 leghorns (Hy-Line, W-36) laying hens on the second cycle of production (at 72 to 80 weeks old) were used in a completely randomized design with three treatments, five replicates and six hens per replivate. The treatments were various levels of VAC fruit powder including zero, 1, and 2% levels of VAC fruit powder per kg of diet. After extraction of total RNA, RNA quality was evaluated using Nanodrop and agarose gel electrophoresis and cDNA was synthesized using a Sinaclone kit. Eventually, gene expression was measured by the real-time qPCR method. In this method, 𝜷-actin gene was used as a reference gene to normalize the gene expression data. To confirm the specificity of each primer, its melting curves were examined.

Electrophoresis of the PCR products showed the 60, 133, and 150-bp fragments for OVAL, OVM, and Beta-actin, respectively. Melting peaks analysis on the PCR products for all primers confirmed minimal primer-dimers and primer specificity. The results of the real-time qPCR method indicated that supplementation of VAC fruits powder at levels 1 and 2 to the diet of laying hens has no effect on the expression of OVAL and OVM genes of laying hens in the second production cycle.

Therefore, Adding VAC fruit powder to the diet of laying hens is not expected to increase egg production in laying hens. Therefore, VAC supplementation is not recommended to the diet of laying hens.

The myxovirus (Mx) gene play a crucial role in the antiviral responses of chicken. The Mx gene is a potential candidate as a genetic resistance marker to the avian influenza virus in chickens. This study was conducted to determine the polymorphism of myxovirus gene polymorphism using PCR-RFLP method in Khuzestan native chicken. In this research, blood samples were collected randomly from 100 Khuzestan native chicken (Malasani, Andimeshk and Shush) and DNA were extracted. Polymerase chain reaction (PCR) was used to amplify 299bp fragments of myxovirus (Mx) gene by specific primers. Then, the amplified fragment was digested with HPY8l enzyme. Allele frequency for A and G, in Shoosh 0.54 and 0.46, Mollasani 0.85 and 0.15 and Andimeshk 0.57 and 0.47 and genotype frequencies of AA, GG and AG, in Shoosh 0.40, 0.33 and 0.27, Mollasani 0.8, 0.1 and 0.1 and Andimeshk 0.45, 0.40 and 0.15 were achieved, respectively. The results showed that the frequency of allele A was higher than G. Furthermore, the observed heterozygosity and the effective number of alleles demonstrated low diversity in the population. Chi-square (X2) analysis showed that the locus allele frequencies are not in Hardy-Weinberg equilibrium. The results of this study suggested that the MX gene had polymorphism and had a high potential for use as a genetic marker for resistance to avian influenza and Newcastle disease.

To determine the best function for describing lactation of Najdi cow in Khuzestan, the day-based milk production test records, collected by Shushtar support station from 1990 to 2014, were used. Records included 2369 data related to 444 first parity cows. To determine the best mathematical function, six functions includind incomplete gamma, wilmink, inverse polynomial, complex logarithmic, Cobby and Le Du, and polynomial regression were evaluated. All functions were fitted using PROC NLIN procedure of SAS software and Gauss-Newton iteration method on day-based milk production test records; and compared based on coefficient of determination R2, corrected coefficient of determination, the mean square error and Akaike index. The results showed that the inverse polynomial function offers a better description for lactation curve in Najdi cattle.  The lactation curve parameters (a, b, c) were estimated 4.4841, 0.2514, 0.00273, and their heritability were 0.354±0.120, 0.280±0.11 and 0.276±0.155, respectively. Moderate heritability suggests the opportunity of genetic response via selection program. Heritability of these traits can be improved by correcting the known environmental impacts.

Indiscriminate use of antibiotics promotes the development of antibiotic resistance and transfer of antibiotic resistance genes from animal to human microbes, Therefore, alternatives should be introduced. This experiment was conducted to this purpose. The 420 one-day-old Japanese quail randomly were allocated in seven experimental treatments, 3 replicate and 20 quail per replicate. The experimental treatments were control diet, and three level from the protexin and virginiamycin (0.25, 0.50 and 0.75%). Compared with control feed intake was reduced by fed treatments containing protexin and virginiamycin in whole period of experiment (P<0.05). The effect of protexin on live and carcass weight and average daily gain was significant; as live body and carcass weight in protexin group was more than control (P<0.05). The diet containing 0.25% protexin had the highest live and carcass weight. The concentration of all measured blood parameters, excepted for IgA and IgG, affected by protexin and virginiamycin in the diet (P<0.05).  The whole colonies of microorganisms, in diet contained 75% protexin or 5% virginiamycin were higher than the control (P>0.05). The Supplemental protexin and virginiamycin resulted to increased the colonies of beneficial bacteria, reduced the population of Escherichia coli, removing of salmonella and increased of the height, width and crypt depth of ileum and jejunum villi in compared to the control. Therefore, the effects of probiotics were matched not only with the effects of antibiotics, but in some cases also had advantages. Therefore, the use of probiotics as an alternative to antibiotics may be recommendable in the diet of birds.

Due to the widespread distribution of SNPs throughout the genome, these markers are widely used in livestock breeding research. These markers were used to predict the disease risk in human, to localize genetic variations responsible for complex traits through genome wide association study (GWAS), and to predict the genetic values of economically important traits in plant and animal breeding (Zhang et al 2015). Mostly whole genome scanning methods are based on two SSGWAS (Single SNP Genome-Wide Association Studies) and multiple markers methods. The SSGWAS method is able to identify a large number of common variables affecting quantitative traits. However, a large proportion of the genetic variance remains to be explained (Shirali et al 2018). In quantitative traits the proportion of phenotypic variance explained by SNPs is related to the number of adjacent SNPs in the genomic region. The heritability created by these genomic regions is defined as the regional heritability. The RHM (Regional Heritability Mapping) method is used to identify small genomic regions. This method can capture more of the missing genetic variation (Nagamine et al 2012). In RHM, a mixed model framework based on Restricted Maximum Likelihood (REML) is used, and two variance components, one contributed by the whole genome and a second one by a specific genomic region, are fitted in the model to estimate genomic and regional heritabilities, respectively (Uemoto et al 2013). Also fastBAT (fast and flexible set-Based Association Test) is a method that performs a fast set-based association analysis (Bakshi et al 2016). The purpose of this study is compare SNPs and regions identified by the Genome-Wide Association methods, compare these results with the simulated QTLs and also investigate and determine the false positive results in each method.

In this study, markers and populations were simulated as a Forward-in-time process using QMSim software (Sargolzaei and Schenkel 2009). For this population, 27586 single nucleotide polymorphisms (SNPs) were counted on 3 pairs of autosomal chromosomes. Simulation was performed in 3 scenarios with 75, 150 and 300 quantitative trait loci (QTL). The minimum and maximum number of SNPs in the analysis after quality control were 19662 and 23817 SNPs, respectively. For each scenario, 10 replicates were simulated, in all scenarios, heritability was 0.2 which corresponded equally to the polygenic and QTLs effects. Whole genomic relationship and pedigree base genetic relationship matrices were used in all 3 methods to estimate genetic parameters. To create the whole genomic relationships matrix, whole genomic additive effects was estimated using all SNPs. Also the additive effect of genomic regions was estimated using the regional genomic relationship matrix. Whole genomic relationships matrix and regional genomic relationship matrix were estimated based on genetic relationships between individuals using SNPs by GCTA software (Yang et al 2011). Pedigree based genetic relationship matrix was created by the kinship relationship between individuals using pedigree package (Coster 2013) of RStudio software (RStudio Inc 2013). To perform RHM and to estimate variance components, windows containing 50 genotyped SNPs were considered. Also windows containing 25 genotyped SNPs to overlap between two consecutive windows throughout the genome were used. SSGWAS analysis were performed by MLMA (Yu et al 2006) method using GCTA software. MLMA results were adjusted based on P-value at 5% significant threshold using Bonferroni correction. To evaluate the results of SSGWAS using fastBAT method, GCTA software was used.

For each replication after identifying significant SNPs, the genetic variance explained by these SNPs was estimated by equation (Faulkner & McKay 1996). In Table 1, the number of QTLs detected by the SSGWAS method, the MAF of QTLs, the range and mean of genetic variance explained by significant SNPs and QTLs are reported. For 30 replicates of simulation in SSGWAS, 16 QTLs were detected containing 2 QTLs with MAF≤0.1 and other detected QTLs with MAF≥0.1. 107 Significant regions were identified in fastBAT method. In this method, 120 QTLs were detected in 3 scenarios containing 52 QTLs with MAF≤0.1. All QTLs detected in the fastBAT and SSGWAS methods were also detected in the RHM method. In RHM method, 612 regions containing simulated QTLs and number of 316 QTLs with MAF≤0.1 were detected. In all replications, the variance explained by SNPs was equal to the variance explained by QTLs. In SSGWAS, less number of QTLs were detected than the other two methods and the maximum variance explained by QTLs was 14.9%. The criterion used to determine false positive QTLs was the absence of significant QTL in the before and after significant windows containing QTLs. In SSGWAS method the percentage of false positive QTLs was higher than the other two methods. In fastBAT, unlike the other two methods, detected QTLs were not false positive. In table 5 Number of detected QTLs, MAF range of QTLs, range and mean of genetic variance explained by detected QTLs and SNPs in fastBAT are shown. Many QTLs and regions detected by RHM method were not detected by SSGWAS and fastBAT methods. The genetic variance explained by detected QTLs in the RHM was at the range of 7.26 to 46.86% that was higher than other two methods. In table 6 the three methods compared by the number of detected QTLs, number of false positive QTLs, number of stable QTLs and the number of detected QTLs with MAF≤0.1. We found that QTLs with MAF≤0.1 were more frequently detected in RHM than the other two methods. These results confirmed that the RHM method was able to identifying more of QTLs affecting the trait variance.

The aim of the current study was to estimate inbreeding coefficient and Annual changes in Moghani sheep. In this research, records of 7278 lambs born from 387 rams and 2433 ewes were used. Data was collected from Jafarabad sheep breeding station in Moghan during 1995-2011. Estimating of inbreeding coefficient was done by CFC program. In total pedigree, 1019 animals were inbred. Averages of inbreeding coefficient for total and inbred population were estimated at 0.6 and 4.4 respectively. The highest inbreeding coefficient was 6.1 % and most inbred animals had inbreeding coefficients lower than 5 %. These results confirmed the low level of inbreeding in the population. Annual trend in inbreeding coefficient for total population were 0.0014±0.0006 and statistically significant (P<0.01). Annual trend in inbreeding coefficient for inbred population were -0.0047±0.0026 and not statistically significant. The regression of inbreeding for birth weight, weaning weight, 6 month weight, 9 month weight and 12 month weight traits were calculated +0.046, 5.16, 1.04, 0.07 and -6.95 gr respectively. Applying a designed mating system like crossbreeding and supervised using of elite rams could be a suitable method to avoid inbreeding depression via keeping the level of inbreeding under control.

The DMB2 gene is one of the MHC cluster genes that plays a role in the humoral immune response. This study was performed to identify the polymorphism of exon 2 of the MHC-DMB2 gene and its association with the humoral immune response in Japanese quail. For this purpose, on day 28, 0.2 mL of 5% saline suspension of sheep red blood cell (SRBC) was injected into 130 quail's breast muscle (65 males and 65 females). Seven days later, cervical vein blood sampling was performed on the 35th day. Afterward, the anti-SRBC titer antibody was determined using a micro hemagglutination technique. Also, genomic DNA was extracted from blood samples and a 333bp fragment of exon 2 was amplified using polymerase chain reaction and PCR products were digested by Hinf 1 restriction enzyme. The results showed that there were two types of C (333bp) and G (226, 107bp) alleles in this region with a frequency of 74.6% and 26.4% in the whole population, respectively. The results indicate high polymorphism and high homozygosity in the studied population. In addition, the results showed that genotype had a significant effect on antibody titers (P<0.01). The CC genotype showed the highest total antibody titer (2.13 mg/dL) and the GG genotype showed the lowest total antibody titer (0.33 mg/dL). It is suggested that the negative effects of this single nucleotide polymorphism be considered in breeding programs.

 Arabi sheep population includes almost 55% of the local sheep population in Khuzestan province. Lamb mortality is a universal problem in sheep breeding that may be reached to 20-40% of total lambs born and could impact the genetic improvement, animal welfare and economic viability of sheep breeding, adversely. Research on improving survival of lambs is likely to have a higher pay-off than research on improving the number of lambs conceived. Lamb survival is a compound trait affected by many various factors related to climate, management, lamb and ewe behavior and genetic effects. Lamb survivability is controlled by genetics of the animal, contributed by direct genetic and maternal effects and also by environmental effects. There are disagreements among researchers about using a suitable model to analyze the survival traits, and each researcher has suggested the use of specific models. In general, the use of linear and threshold models has been suggested for survival trait analysis. Although survival has great economic importance, in the studies conducted on Iranian livestock, less attention has been paid to it. The aim of this study was to analyze the genetic parameters for the survival of Arabi lambs from birth to one year of age using linear and Weibull models.

 in this study, 5452 lamb survival records collected by the Jahad Agricultural Organization of Ahvaz from 1993 to 2005 were used. Traits included were cumulative survival from birth to the end of one year and on a monthly basis. In order to estimate genetic parameters using linear models, the Restricted Maximum Likelihood (REML) method was used in Wombat software based on a univariate analysis. The Weibull model and Matvec software were also used for estimating variance component and genetic parameters of Survival rate.

 Different models compared using the likelihood ratio test. For survival traits until 1, 4, 5, and 10 months, the model 4 was suitable, which include the direct additive genetic effect, maternal additive genetic effect and their covariance. In the case of until 2 months, the best model was the model 3, which include the direct and maternal additive genetic effects. For until 3, 8, 9, and 12 months, model 1 including direct additive genetic effect was selected. And for other traits Model 5 (direct additive genetic, maternal additive genetic, and maternal permanent environmental effects) was chosen as the best model. The direct heritability of survival rate estimated from different linear models was in the range of 0.025 to 0.061. In general, despite the high economic importance of survival in the breeds until one year of age, due to low estimates of the inheritance of these traits using linear models, it cannot be expected that genetic selection alone can make significant genetic progress. The genetic variance component among sires, heritability on the logarithmic scale, heritability on the original scale, and effective heritability obtained from Weibull sire model were increased to a peak point at 4 months. After that, a decline occurred until 5 months, and then a fluctuation was observed until 9 months. A limited increase was found in the 11 and 12 months. The heritability of sire model, in the logarithmic scale, had a low to medium range (0.13-0.25), and in the original scale had a medium to high range (0.39-0.75). The effective heritability was estimated in the medium range. Estimated values of the survival heritability using the Weibull model was greater than the value obtained from the linear animal model. Although heritability estimations for survival and mortality is low, it is possible that genetic progress may be enhanced by selecting lambs with higher breeding value for survival.

 Estimation of the genetic parameters for survival lambs from birth to one year of age using linear and Weibull models were low vs medium to high, respectively. Therefore, based on the results of linear models, response to  direct selection to improve the survival of lambs in this breed will be very slow, and more attention should be paid to improving non-genetic factors and indirect selection and outbreeding, but based on The results of Weibull models, it seems that the rate of response to genetic selection to improve survival trait is faster using these models compared to the linear models, suggest that lamb survival could be improved  through direct selection and could be included in the Arabi sheep selection  index.

Gonadotropin-releasing hormone (GnRH) is a key regulatory molecule of the hypothalamus–pituitary gonadal axis which induces transcription of luteinizing hormone (LH) from the anterior pituitary. Research has shown that estrogen plays an important role in regulating GnRH. Also, recent experiments indicated that Vitex agnus-castus (VAC) has high levels of phytoestrogen. Hence, this research was performed to investigate the effect of Vitex Agnuse Castus (VAC) fruit powder on GnRH and LH genes expression in laying hens using Real time qPCR technique. For this purpose, 90 Hy-line W-36 leghorn (at 72 to 80 weeks old) were used in a completely randomized design with 3 treatments, 5 replicates and 6 hens per replicate for 56 days as an experimental period. The three experimental treatments were: 1- control diet (basal diet without any additives), 2- basal diet plus 1% VAC fruit powder, 3- Basal diet plus 2% VAC fruit powder. At the end of the experiment one hens were slaughtered and their hypothalamus was rapidly separated and transferred to the laboratory with liquid nitrogen. Then, RNA was extracted and used for cDNA synthesis. Finally, GnRH gene expression was evaluated by Real-Time qPCR. The ANOVA results showed that GnRH gene expression was significantly increased in treatment 3 (diet containing 2% VAC) compared to the control and 1% VAC groups (P <0.01). While, addition of 1% VAC fruit powder to diet had no significant effect on GnRH gene expression (P> 0.05). Furthermore, addition of 1 or 2 % VOC fruit powder had no significant effect on LH gene expression (P> 0.05). The results of this study showed that the addition of VOC fruit powder fruit powder up to 2% level could not affect the pituitary-hypothalamic axis of laying hens at 72 to 80 weeks old.

Goats are highly adapted domesticated species and are considered as genetic resources for human beings around the world. Protecting and identifying genetic diversity in goat populations is imperative because of the risk of a severe decline. The Adani dairy goat is one of the most important indigenous goat breeds of Iran and is reared in the coastal area of the Persian Gulf in Boushehr province. In spite of high temperatures, humidity and low quality and quantity pastures, the breed has been well adapted to the harsh environmental conditions. Considering the importance of conservation of indigenous breeds adapted to harsh environmental conditions, the objective of the current study was to determine the maternal line and the phylogenetic relationship Adani goat breed using hyper variable region 1 (HVR 1). For this purpose, blood samples were collected from 12 Adani goats of Bushehr province. After DNA extraction, a 968 base pair fragment was amplified by specific primers using the PCR method and sequenced. Analysis of HVR1 sequences showed 10 haplotypes with 42 different positions. Moreover, the haplotype and nucleotide diversity based on HVR1 region were estimated 0.954 and 0.0123, respectively. These results indicate high genetic variation in Adani goat. The phylogenetic tree pattern revealed that the Adani goat was clustered with Afar breed from Ethiopia and also, was classified into haplogroup A. This could be due to the geographical location of Bushehr province and its location next to the Persian Gulf and the Sea of Oman.

In the present study, blood samples were collected from 97 Adani goat from Bushehr province in order to identify the polymorphism in the exon II region of MHC-DRB1 gene (Major Histocompatibility Complex) and also, its association with growth traits (birth weight and 3 months weight). Genomic DNA was extracted from blood samples. A 279-bp fragment was amplified using polymerase chain reaction (PCR). Eventually, the PCR products were digested by RasI enzyme. The results showed that there were 4 types of alleles A, B, C and D in this locus with the frequencies of %51, %26.8, %13.4 and %8.8, respectively. Five genotypes including AA, AB, BB, AC and AD were identified with the frequency of %14.432, %28.866, %12.371, %26.80 and %17.525, respectively. The results indicated polymorphism and high heterozygosity in the population under study. Also, the number of effective alleles, Shannon index, expected and observed heterozygosity for this site was calculated at 2.794, 1.179, 0.642 and 0.732, respectively. Moreover, the chi-square (χ2) test showed that population was not in Hardy-Weinberg equilibrium. The ANOVA results showed that the effect of different genotypes on birth weight was significant (p<0.05), but it was not significant on 3 MW (p<0.05). Furthermore, other traits such as dam age, sex, season and birth type effects were not significant on the growth traits (p<0.05). The highest birth weight was found for heterozygous AC and AD genotypes (3.05 and 3.02 Kg, respectively), and the lowest birth weight was related to pure AA genotype (1.75 Kg). It seems that selecting AC and AD genotypes can be expected to increase birth weight in Adani goat. Also, we expect that this gene can act as a candidate gene for genetic improvement of some growth traits in goat breeding programs.

The present study was conducted to evaluate the effect of Tribulus Tresstrise (TT) herb on sex ratio of semen in Arabic Khouzestan ram using real time-qPCR technique using 18 rams in a completely randomized design with 3 treatments. The SRY and PLP genes were amplified to isolate the specific fragments of Y- and X- chromosome sequences. The treatments included: i) the control group (0% TT), ii) Diet containing 15 g/kg TT, iii) Diet containing 30 g/kg TT. Sperm sampling was taken from all rams at 10 month of age and blood sampling was performed at 8 and 10 month of age. The results showed that expression rate of SRY gene increased with increasing TT level and rams that received 30 g/kg TT diet had the highest SRY gene expression and PLP gene expression decreased with increasing TT level (p-value =0.004). There was positive correlation between Testosterone concentration and SRY gene expression at 8 (0.65) and 10 (0.59) month of age, and the relationship between PLP gene expression and Testosterone concentration was negative and -0.61 and -0.66 at 8 and 10 month of age, respectively (p-value= 0.006). The results indicated that adding Tribulus Tresstrise herb to the ram diet increases the SRY gene expression and also sperm containing Y chromosome. In other words, it increases the sex ratio toward male gens in Arabic Khozestan ram by increasing the androgen hormones.

Identification of genetic characteristics is an important factor for preservation of species life. The aim of this study was to identify the genetic characteristics of the Adani goat populations based on the cytochrome b (Cyt b) gene and to detec its phylogenetic relationships with the domestic and wild goat species using NCBI database. Blood samples were taken from 12 Adani goat and subsequently DNA was extracted using Sinaclon kit. The target area (892 base pair) was proliferated by specific primers using polymerase chain reaction (PCR) method and then sequenced. By analyzing the sequences, 5 haplotypes were identified based on 12 polymorphic sites. All mutation sites were transition and nonsense. The haplotype and nucleotide diversity and the average of a different nucleotide based on Cyt b region were estimated 0.57, 0.002 and 2.273, respectively. These results indicated high genetic variation in Adani goat. Using the NJ phylogenetic test results indicated that the Adani goat was located in the C. hircus branch and C. Aegagrus was in closer to them in compare with C. ibex. The placement of Capra hircus's goats and Adani goats in a similar branch is rational because of the dispersion of various races of this species throughout the world.

The effects of two different extenders were investigated (Tris- egg yolk and Andromed extenders) on semen quality and sex ratio during the dilution and freezing process in Holstien bull by using the real-time qPCR technique. The experiment was conducted using four 4-years old Holstien bulls for a period of four weeks in a completely randomized design. The PLP and SRY genes were amplified to isolate the specific fragments of X- and Y- chromosome sequences, respectively. Using Andromed diluent in comparison with Tris- eggs yolk improved semen quality during freezing and thawing. Using Andromed extender significantly increased the PLP gene expression (1.43±0.16), (P= 0/01) and reduced SRY gene expression (0.64±0.11), (P= 0/009). Using Tris- egg yolk extender led to a significant reduced in expression of PLP gene (0.3±0.06), (P< 0/0001) and s increased SRY gene expression during freezing (1.19±0.05), (P= 0/001). Based on the results, sperm dilution with Andromed extender and frozen semen with Tris-egg yolk increase birth of female and male in dairy cow herd, respectively.

Feathers, a largely wastes produced in poultry industries represents a rich insoluble protein resource containing over 90% keratins. The aim of this study was to analyze and characterize the diversity of keratinase producing bacteria in broiler chicken litter house. A total of 10 gram samples were cultured in skim milk agar. The isolates were cultured on keratine and Azokeratin agar medium using keratin as the sole source of carbon to isolate keratinolytic microbes. The colonies with high feather hydrolyzing ability were subjected to identification by microscopic observation, biochemical characterization and molecular analysis. The results showed that among a total of 10 bacterial strains obtained from skim milk agar plates with proteolytic activity, only four bacteria were capable of degrading keratin. According to the biochemical and morphological characters, the isolated strain was grouped under the genus of Coccus (Staphylococcus). Based on 16S rRNA typing and phylogenetic analysis this strain was identified as Staphylococcus lentus SLKr1 and according to diameter clear zone on keratin agar medium, exhibited higher level of keratinolytic activity among other isolated strains. Staphylococcus lentus SLKr1 as a new keratinase producing bacteria also possessed high caseinase activity but was negative in amylase, lecithinase, cellulase and gelatinase production. Taken together, these results suggest Staphylococcus lentus SLKr1, a new keratinase producing bacteria with high keratinolytic activities which have the potential use in industrial biotechnology.

Bovine ephemeral fever (BEF) is a viral disease of cattle and water buffalo seen in some provinces of Iran, generally southern and warm regions in recent years. The G glycoprotein is the main protective antigen of the bovine ephemeral fever virus (BEFV) and the target of anti-BEFV neutralizing antibodies. The aim of the present study was cloning and expression of the G1 epitope of BEF virus G glycoprotein gene in a prokaryotic system. For this purpose, the G1 epitope was cloned in a prokaryotic expression vector, pET-24a(+), under the control of the T7 promoter and subsequently the recombinant pET24-G1 construct was transformed into Rosetta strain of Escherichia coli. Expressed recombinant protein was analyzed using SDS-PAGE and immunoblotting methods. SDS-PAGE analysis showed that a protein with ~18 kDa molecular weight, consistent with the expected molecular weight of recombinant protein fused to 6xHis tag, was expressed. Immunoblotting analysis showed that the expressed G1 protein specifically reacted with a mouse polyclonal serum against BEFV. Thus, in this study the G1 protein of BEFV was successfully expressed by the pET24-G1 recombinant construct in Escherichia coli. Based on the results of this study, immunization and the efficacy of this product can be consider as a possible candidate for the production of subunit vaccine against the virus in animal models.

Genomic technologies, such as high-throughput genotyping based on SNP arrays, have great potential to decipher the genetic architecture of complex traits and provide background information concerning genome structure in domestic animals, including the extent of linkage disequilibrium (LD). In this study, Illumina OvineSNP50 BeadChip array was used to estimate and compare LD, effective population size (Ne) and heterozygosity in three Iranian sheep populations consisting Afshari (N=41), Moghani (N=35) and Qezel (N=35) breeds. The average LD (measured by r2) estimated for all pairwise combinations of SNPs with average distance 58, 56 and 56 Kb were 0.151 ± 0.207 for Afshari, 0.131± 0.190 for Moghani and 0.121 ± 0.148 for Qezel breeds, respectively. The highest averages of r2 on autosomes were obtained for chromosome 2 in Afshari and Qezel and chromosome 12 in Moghani breeds. The Qezel breed showed highest genetic diversity based on effective population size and heterozygosity, whereas the lowest value was found in Afshari breed. Due to low LD values estimated in this study, the results showed to achieve the genomic prediction accuracy of 85% in genomic selection and association studies, the density of marker must be higher than 50K SNPChip.

This research was conducted at the Department of Animal Science in the Ramin Agriculture and Natural Resources University in 2014-2015. The elevation of egg production and the inhibition of incubation behavior are the aims of modern poultry production . Prolactin is postulated to play a critical role in the onset and maintenance of incubation behavior in birds .In avian, dopamine inhibits prolactin secretion in the brain. So far, at least five distinct dopamine receptor subtypes, DRD1-DRD5, have been identified and classically divided into two classes referred to as D1-like (DRD1 and DRD5) and D2-like (DRD2,DRD3, and DR 4) .DRD1 is located on chromosome 13 and contains an open reading frame of 1356 nucleotides encoding a protein of 451 amino acids. Dopamine stimulates prolactin secretion via activating DRD1 at the hypothalamus level by operating through vasoactive intestinal peptide and the inhibition effect of dopamine on Prolactin secretion is mediated through DRD2 receptors at the pituitary level.This study aimed at identification of the variants of dopamine D1 receptor gene and detection of the allelic frequency in the Khuzestan native chicken at Ramin Agriculture and Natural Resources of Khuzestan province.
For this research 100 laying hens from Khuzestan native chicken Breeding Center (Jahed Livestock Input Corporation) were randomly selected. DNA was extracted from whole blood using salting-out procedure. The PCR-RFLP method was used for allelic differentiation. Dopamine D1 receptor gene was amplified by a specific set of primer for this gene to produce 283 bp fragment. The PCR reactions were carried out in a total volume of 25 μL containing 150 ng of genomic DNA, 1 μL of each primer, .5 μL dNTP, 1 μL MgCl2, 2.5× PCR buffer and 1 U of Taq DNA polymerase. The amplification was performed in a Eppendorf Mastercycler under the following conditions: 95°C for 3 min; 35 cycles of 95°C for 30 s, 58/4°C for 45 s and 72°C for 30 s; and 72°C for 10 min. The amplified fragment was digested with BseN I restriction enzyme. The digestion mixture was composed of 10μL PCR products, 2μL digestion buffer, and 1μL of each enzyme, and then subjected to electrophoresis separation in 2.5% Agarose gel.
The results of the enzyme Restrictive BseNI showed only one A allele and AA genotype and polymorphism was not observed. To determine the quality and quantity of DNA, Nanodrop and Agarose gel was used and the results showed that the extracted DNA was suitable to continue the research. The results of this study were not in par with those of the previous research. Such non compliance could be due to the kind of population studied, the sample size and the type of marker based on which polymorphic was examined. Due to the limited number of cutting sites in restriction enzymes, various DNA fragments were not produced. Therefore, RFLP markers may have not been able to identify all mutations in this sequence. Dopamine receptor gene in Khuzestan native chicken was sequenced for the first time in the present study. Hence, alignment sequences of Khuzestan native chicken and alignment sequence in ClastaW2 were saved in the gene bank. The results of sequencing in ClastaW2 recorded two mutations of type A to G in the base 12 and C to T in the base 198.
Considering the results of gene sequencing, it cannot be stated that a dopamine receptor in this research is monomorphic. However, the enzyme used for dopamine gene could not be able to recognize the restriction sites. Sequencing of dopamine D1 receptor gene in the native chicken population of Khuzestan showed mutation which normally causes genetic polymorphism. However, in this study due to the ineffective choice of the enzyme, monomorphism was detected. These results show the importance of restriction enzyme in detecting genetic variation. Since dopamine is one of the main factors known to reduce prolactin and decrease broodiness as well as the reports indicated that mutations in dopamine D1 receptor different genotypes were significantly associated with increased dopamine.
Due to the important role of restriction enzymes in identification of different mutations, selection of the suitable enzyme is recommended.