محمد تقی بیگی نصیری
-
مطالعه حاضر به منظور بررسی امکان سنجی تعیین جنسیت جنین مرغ بومی ایران با استفاده از طیف سنجی رامان انجام شد. تعیین جنسیت جنین ها با استفاده از طیف سنجی رامان با طول موج nm785 در روز 5/3 انکوباسیون انجام گرفت. صحت سنجی این روش با استفاده از روش واکنش زنجیره ای پلیمراز مورد بررسی قرار گرفت. طیف های به دست آمده از طیف سنج رامان با استفاده از نرم افزار Origin رسم شده و مورد تجزیه و تحلیل قرار گرفتند. شاخص های اصلی مورد استفاده جهت تجزیه و تحلیل طیف رامان، شدت اوج های رامانی و نسبت شدت اوج های غالب بودند. در واکنش زنجیره ای پلیمراز، یک قطعه به طول 461 جفت باز برای جنین های با جنسیت نر (ZZ) و دو قطعه با طول های 461 و 322 جفت باز برای جنین هایی با جنسیت ماده (ZW) تکثیر شد. نتایج طیف سنجی نشان داد شدت باندهای رامانی در جنسیت های مختلف متفاوت است، به طوری که شدت باندهای رامانی در جنس نر، بیشتر و در جنس ماده، کمتر بود. بنابراین، تغییرات شدت طیف های رامان را می توان ملاک تشخیص جنسیت قرار داد. همچنین، نتایج حاصل از رسم نمودار شمعی داده ها به صورت تجمعی نشان داد که مقادیر میانه و میانگین در هر دو نسبت برای جنسیت نر دارای مقدار بزرگتری در مقایسه با جنسیت ماده بود. با توجه به نتایج به دست آمده، این گونه استنباط می شود که طیف سنجی رامان می تواند به عنوان روشی مناسب جهت تعیین جنسیت جنین مرغ طی مراحل جوجه کشی مورد استفاده قرار گیرد و به دلیل کوتاه بودن زمان انجام آزمایش می تواند بهترین شرایط را برای استقرار در صنعت فراهم کرده و جنسیت را با دقت بالا مشخص نماید.کلید واژگان: تعیین جنسیت, جنین مرغ, طیف سنجی رامان, واکنش زنجیره ای پلیمرازIntroductionThe sex of chickens considerably impacts production performance and economic benefits in poultry farming. Male birds cannot lay eggs and usually have a lower ratio of meat to feed than broilers. Male chicks are typically killed immediately after hatching since they are redundant in the industry and male chicks will neither be suitable for egg production nor meat production. Day-old male chicks in the laying hen industry are usually culled immediately after hatching. As a result, this issue has caused moral concerns in societies. Efforts are underway to develop technology for automatically determining the sex of chick embryos, aimed at establishing a stable and efficient poultry farming system. In large commercial hatcheries, the sexing of newly born chicks is generally accomplished by three different methods according to new hatching lines' vent, color, or feathers. However, these methods are still time- and labor-consuming. If sex can be identified at an early embryonic stage or even before incubation, male eggs could be used as feed components. Moreover, fewer eggs would need to be incubated, which would reduce feed space requirements, CO2 emissions, and energy consumption, which are all economically beneficial to farmers and the environment. In recent decades, researchers have used various in ovo sexing strategies in chicken eggs before hatching or incubation. Some invasive and noninvasive studies that have been conducted for in ovo sexing of chicken eggs can be divided into five major categories: (i) molecular-based techniques, (ii) spectral-based techniques (Raman spectroscopy, fluorescent, 3D X-ray), (iii) acoustic-based techniques, (iv) morphology-based techniques, and (v) volatile organic compound (VOC)-based techniques. Commercially applicable methods must be noninvasive, rapid enough for real-time applications, economically feasible, and ethically acceptable. An alternative method, to prevent the removal of day-old chicks, is a non-invasive method to determine the sex of the egg in the early stages of hatching before the development of the nervous system. Recently, Raman spectroscopy was reported to determine the sex of eggs at the incubation stage. Raman spectroscopy is based on the Raman effect, whereby when incident light (wavelength 750–850 nm) excites molecules in a tissue, the molecules reflect light at a different wavelength. The reflected light's wavelength is characteristic of various chemical components and allows the detection of the atheromatous plaque chemical synthesis. Raman spectroscopy is a powerful tool expected to revolutionize chick sex determination because it can provide information about biological molecules. Thus, Raman spectroscopy is suitable for analyzing living organisms, leading to its widespread adoption across various biological and medical applications. Therefore, resonance Raman spectroscopies have found application in blood analysis, with some studies exploring its utility in chick sexing. For this purpose, the present study was carried out to investigate the feasibility of determining the sex of Iranian native chicken embryos using the Raman spectroscopy.Materials and methodsTo carry out this research, 100 fertilized eggs of Iranian native chickens were used. The sex of the embryos was determined using Raman spectroscopy with a wavelength of 785 nm during the fourth day of incubation. Validation of this method was investigated using the polymerase chain reaction (PCR) technique. Sequence alignment of CHD-Z and CHD-W allele sequences amplified by PCR technique. The amplified DNA fragments were single and double DNA bands in the size of 461 bp for the CHD-Z and 322 bp for the CHD-W genes. The PCR was carried out using a PCR master kit with specific primers (the forward primer: 5′- TATCGTCAGTTTCCTTTTCAGGT -3′, the reverse primer: 5′- CCTTTTATTGATCCATCAAGCCT -3′). Thermal cycling conditions for DNA amplification were: 1 cycle of initial denaturation at 94°C for 5 minutes; 35 cycles comprising 30s at 94°C for the denaturation, 30s at 59°C for annealing, 30s at 72°C for the elongation; and a final extension cycle at 72°C for 5 minutes. The PCR products were analyzed by electrophoresis on 2.5% agarose gel against a DNA Ladder 100bp, and visualized using the safe staining on UV transilluminator. The data obtained from the Raman spectrometer was analyzed using the Origin software. The main indices used to study the data were the intensity of the Raman peaks and the ratio of the dominant peak intensity. Additionally, principal component analysis (PCA) was employed to identify any patterns in the data. To calculate PCA1 and PC2, the ratios of I769/I838 and I1141/I1251 peaks were considered, respectively. PCA analysis can choose features that have a greater impact on the final result, depending on the data and the scope of their changes.Results and discussionThe result of PCR showed that one fragment with a length of 461 bp was amplified for male embryos (ZZ) and two fragments with lengths of 461 and 322 bp were amplified for female embryos (ZW(. The study found that there are differences in the intensity of Raman bands between genders. Males have higher intensity while females have lower intensity. Therefore, changes in Raman spectra intensity can be used to identify gender. Additionally, the candlestick chart of the data showed that median and average values for males were larger than for females. Furthermore, the results obtained from PCA analysis showed that the variance percentages for PC1 and PC2 were 53.69% and 46.31%, respectively. PC2 is more reliable as it has less deviation.ConclusionsBased on the results obtained from the study, it can be concluded that Raman spectroscopy is a reliable method for determining the gender of chicken embryos during incubation. This test is quick, accurate, and can be easily incorporated into the industry to determine the gender of embryos without resorting to the practice of killing day-old chicks. Not only is this method more ethical, but it also offers a high level of accuracy, making it an attractive alternative for the industry. In general, these results demonstrate the potential application of hematological traits in developing an automatic in ovo embryo sexing method through spectroscopic analysis.Keywords: Sex Determination, Chicken Embryo, Raman Spectroscopy, Polymerase Chain Reaction
-
در این تحقیق، به منظور بررسی اثر توارث سیتوپلاسمی برصفات رشد، از تعداد کل 19717 رکورد مربوط به گوسفندان عربی استفاده گردید. با دنبال کردن لاین های سیتوپلاسمی از نتاج به والد مبنا، منابع اولیه سیتوپلاسمی مشخص شد. نرم افزار آماری SAS جهت تعیین عوامل محیطی موثر بر این صفات و از نرم افزار MTGSAM جهت برآورد پارامترهای ژنتیکی، با روش آماری بیزی مورد استفاده قرار گرفت. اثرات ثابت شامل جنس ، تیپ تولد ، سن مادر و سال تولد در سطح (01/0 <p) معنی دار به دست آمد. در روش آمار بیزی براساس کمترین میزان معیار آکائیک بهترین مدل ها برای صفات وزن تولد، سه ماهگی، شش ماهگی، نه ماهگی و یکسالگی به ترتیب مدل های 5 ، 5 ، 3 ، 4 ، 3 بودند. مقدار توارث سیتوپلاسمی به دست آمده برای وزن تولد، سه ماهگی به ترتیب برابر با 02/ 0و 03/0 و برای وزن شش ماهگی، نه ماهگی و یکسالگی توارث سیتوپلاسمی مشاهده نشد. همچنین مقدار واریانس سیتوپلاسمی مشاهده شده برای وزن تولد و وزن سه ماهگی در گوسفندان عربی به ترتیب برابر با 004/0 و 41/0 و برای وزن شش ماهگی تا یکسالگی واریانس سیتوپلاسمی مشاهده نگردید. به طور کلی اگرچه برای صفت وزن سهم اثر توارث سیتوپلاسمی کم بود اما منظور نمودن اثرات مادری و اثر توارث سیتوپلاسمی باعث برآورد دقیق تری از پارامترهای ژنتیکی صفات رشد بدن در تمام سنین خواهد شد.
کلید واژگان: روش بیزی, گوسفند عربی, صفات رشد, سیتوپلاسمIn order to evaluate cytoplasmic inheritance of growth traits (including birth weight, 3, 6, 9 and 12 month weight), the total number of 19717 Arabic sheep records which was collected by Agricultural Organization of Khuzestan province was used during1989 to 2010. Following the cytoplasmic lines from progeny to the parents, cytoplasmic primary sources were identified. Environmental factors affecting these traits were analyzed by SAS statistical software. Genetic parameters were estimated using Bayesian statistical method and MTGSAM software. Significant effect (P <0.01) on traits including lambs sex, birth type, maternal age and birth year were found. Based on the lowest acacia criteria in Bayesian statistical method, models 5, 5, 3, 4, 3 for birth weight, 3, 6, 9 and 12 months were the best models respectively. The cytoplasmic inheritance for birth weight, 3 months of age was 0.02, 0.03, and for the weights at 6, 9 and 12 months age, there was no cytoplasmic inheritance. However, the observed cytoplasmic variance for birth weight and 3 months old weight in Arab sheep were 0.004, 0.410, respectively, while no cytoplasmic variance for 6 to 12 months old was observed. Generally, although for the weight trait the share of cytoplasmic inheritance was low, but considering maternal effects and cytoplasmic heritages would result in a more accurate estimation of the genetic parameters of the growth traits of all ages.
Keywords: Bayesian Method, Arabic Sheep, Growth Traits, Cytoplasmic -
برای محافظت از نژادهای بومی به منظور حفظ تنوع ژنتیکی، نگهداری حیوان در محل زندگی خود است چرا که هزینه محافظت از ذخایر ژنتیکی بالا بوده و امکان حفظ همه ذخایر ژنتیکی در آزمایشگاه ها و موسسات تحقیقاتی ممکن نیست. هدف از این تحقیق مشخص کردن ساختار جمعیتی و اندازه موثر جمعیت گاو نجدی، هلشتاین و آمیخته های آنها در گله های استان خوزستان بود. به این منظور از اطلاعات ژنومی 329 نمونه گاو شامل 141، 60 و 128 نمونه به ترتیب از نژادهای هلشتاین و آمیخته و نجدی استفاده شد. نمونه ها با آرایه های ژنومی Illumina SNP30K تعیین ژنوتیپ شدند. آنالیز جمعیت با استفاده از PCA و plotNJ انجام شد که در هر دو روش جمعیت ها تا حدودی از هم تفکیک شدند. دامنه r2 از 359/0 ± 150/0 26 تا 450/0 ± 244/0 در کروموزوم در 20 برای نژاد هلشتاین و 319/0 ± 130/0 28 تا 462/0 ± 271/0 در کروموزوم 20 در دام های آمیخته بود، در حالیکه بالاترین مقدار r2 در نژاد نجدی از دامنه 311/0 ± 120/0 28 تا 483/0 ± 271/0 در کروموزوم 20 مشاهده شد. اندازه موثر جمعیت ها در نسل پنج برای جمعیت های این مطالعه، نجدی 45 راس، آمیخته 101 راس و هلشتاین 110 راس به دست آمد. این اعداد برای گاو نجدی برای مقادیر پیشنهاد شده جهت حفاظت از جمعیت ها فاصله زیادی دارد و این امر نشان دهنده خطر جدی حذف گاو بومی نجدی در آینده نزدیک است.
کلید واژگان: گاو نجدی, گاو هلشتاین, ساختار جمعیت, اندازه موثر جمعیت, عدم تعادل لینکاژیThe purpose of this research was to determine the population structure and effective population size of Najdi, Holstein and their hybrids in the herds of Khuzestan province. For this purpose, the genomic information of 329 cattle samples including 141, 60 and 128 samples from Holstein, mixed and Najdi breeds were used. The samples were genotyped with Illumina SNP30K genomic arrays. Population analysis was done using PCA and plotNJ, and in both methods the populations were somewhat separated. The range of r2 is from 0.150 ± 0.359 in chromosome 26 to 0.244 ± 0.450 in chromosome 20 for the Holstein breed and 0.130 ± 0.319 in chromosome 28 to 0.271 ± 0.462 in chromosome 20 in were mixed livestock, while the highest value of r2 was observed in the Najdi breed from the range of 0.120 ± 0.311 in chromosome 28 to 0.271 ± 0.483 in chromosome 20. The effective size of the populations in the fifth generation for the populations of this study was 45 Najdi heads, 101 mixed heads and 110 Holstein heads. These numbers for Najdi cattle are far from the recommended values for the protection of populations, and this indicates a serious risk of eliminating native Najdi cattle in the near future. Reducing the effective size will increase the sensitivity of this population to the upcoming environmental changes.
Keywords: Najdi cattle breed, Holstein cattle, population structure effective, population size, linkage disequilibrium -
این پژوهش به منظور شناسایی و اعتبارسنجی نشانگرهای توالی ساده تکراری (SSR) مربوط به گونه ماهی گطان (Luciobarbus xanthopterus) با استفاده از داده های RNA-Seq انجام شد. پس از جداسازی بافت کبد، استخراج RNA از نمونه ها انجام گرفت. نمونه ها با استفاده از پلتفرم ایلومینا Novaseq 6000 توالی یابی شدند. برای بازسازی رونوشت ها، از نرم افزار Trinity (نسخه 2.15.1) استفاده شد. شناسایی SSRs با استفاده از از پایگاه MISA انجام شد. پرایمرهای مورد نیاز در واکنش زنجیره ای پلیمراز برای 5 نشانگر SSR با نرم افزار PRIMER 3 طراحی و بر 45 ماهی گطان مورد ارزیابی قرار گرفت. سرهم بندی رونوشت ها با برنامه Trinity، 941،894 یونی ژن و 1،768،662 ترانسکریپت ایجاد کرد. در این مطالعه، بررسی 1،276،825 توالی به وسیله نرم افزار MISA، منجر به شناسایی تعداد 349،871 نشانگر SSR شد. در میان SSRs ، تکرارهای دو و سه نوکلئوتیدی به ترتیب با 37/89 درصد و 05/8 درصد، بیشترین تعداد تکرار را به خود اختصاص دادند. 5 پرایمر مورد استفاده، 2 جایگاه چندشکلی را نشان دادند. هتروزیگوسیتی مورد انتظار و مشاهده شده برای جایگاه MN1359 به ترتیب 785/0 و 147/0 و برای جایگاه GM1371 به ترتیب 770/0 و 093/0 محاسبه شد. به علاوه، آزمون کای مربع نشان داد که جمعیت برای هر دو جایگاه در تعادل هاردی-وینبرگ قرار ندارد. نتایج ارزیابی معیار های مختلف تنوع ژنتیکی همگی گویای کاهش تنوع در بین جمعیت مورد مطالعه بود. به طور کلی، نتایج این تحقیق نشان داد که SSRs جدید می توانند برای اصلاح نژاد، مطالعات ژنومیک عملکردی و بررسی تنوع ژنتیکی ماهی گطان مفید باشند.
کلید واژگان: گطان, RNA-Seq, ترانسکریپتوم, توالی های ساده تکراریThis research was conducted to identify and validate the simple sequence repeats (SSR) markers related to yellowfin barbel (Luciobarbus xanthopterus) using RNA-Seq data. After collecting the liver tissue, RNA was extracted from the samples. The samples were sequenced using the Illumina Novaseq 6000 platform. Trinity software (version 2.15.1) was used to reconstruct transcripts. Identification of SSR was done using the MISA web server. The primers needed in the polymerase chain reaction for 5 SSR markers were designed by PRIMER 3 software and validated using 45 yellowfin barbel. Transcript assembly by the Trinity program generated 941,894 unigenes and 1,768,662 transcripts. In this study, the examination of 1,276,825 sequences by MISA software led to the identification of 349,871 potential SSR markers. Among the SSRs, di- and trinucleotide repeats had the highest number of repetitions with 89.37% and 8.05%, respectively. From the 5 primers used, only two of them showed polymorphism. The expected and observed heterozygosity for the MN1359 locus were calculated as 0.785 and 0.147, and for the GM1371 locus given 0.770 and 0.093, respectively. Moreover, the chi-square test showed that population was not in Hardy-Weinberg equilibrium. The results of different genetic diversity criteria showed a decrease in diversity in yellowfin barbel. Generally, this research showed that the new SSRs can be helpful for molecular breeding, functional genomics studies, and the genetic diversity analysis of yellowfin barbel.
Keywords: Yellowfin Barbel, RNA-Seq, Transcriptome, Simple Sequence Repeats -
عقرب Hemiscorpius lepturus کشنده ترین عقرب ایران است و به همین جهت از نظر پزشکی اهمیت زیادی دارد. علائم بالینی ناشی از مسمومیت با زهر عقرب H. lepturus، مانند اثرات سمی نروتوکسیسیتی، سوزش های پوستی و همچنین برخی از واکنش های التهابی به فعالیت فسفولیپاز A2 (PLA2) آن نسبت داده شده است. هدف این مطالعه شناسایی و دسته بندی ژن های کدکننده فسفولیپاز A2 در غده زهر عقرب H. lepturus است. به همین منظور در این مطالعه، یک کتابخانه cDNA از غدد زهر این عقرب با استفاده از تکنیک توالی یابی RNA ایلومینا تولید شد. توالی های کد کننده PLA2 با استفاده از ابزار اصلی جستجوی تراز محلی (BLAST) و جستجوهای تشابه بین داده های خام غده زهر با توالی های ثبت شده از بندپایان دیگر به ویژه عقرب Centruroides sculpturatus شناسایی و استخراج شدند. این جستجوها منجر به یافتن چندین توالی همولوگ از PLA2 در غدد زهر این عقرب با شباهت توالی به فاکتور فعال کننده پلاکت استیل هیدرولاز (PAFA)، PLA2 های وابسته به کلسیم (cPLA2)، PLA2 های ترشح شونده (sPLA2)، PLA2 های مستقل از کلسیم (iPLA2) و گروه III هترودیمریک فسفولیپاز A2 (hgPLA2) شد. اغلب توالی های یافت شده بیشترین شباهت را با توالی های PLA2 از عقرب های C. sculpturatus و Androctonus crassicauda نشان دادند. این گزارش یکی از معدود تلاش های توالی یابی رونوشت برای شناسایی، دسته بندی و تعیین خصوصیات فیزیکوشیمیایی توالی های PLA2 در غده زهر عقرب همی اسکورپیوس لپتروس است که در آن روابط فیلوژنتیکی بین بندپایان مختلف با استفاده از توالی های شناسایی شده از جنس Hemiscorpius بررسی شده است.
کلید واژگان: عقرب, Hemoscorpius Lepturus, غده زهر, فسفولیپاز A2, کتابخانه Cdna, روابط فیلوژنتیکیThe scorpion of Hemiscorpius lepturus is the deadliest scorpion in Iran, so it is very important from a medical point of view. Clinical symptoms caused by H. lepturus scorpion envenoming such as neurotoxic effects, skin burns, and some inflammatory reactions have been attributed to its phospholipase A2 activity. The aim of this study is to identify and categorize the genes encoding phospholipase A2 in H. lepturus scorpion venom gland. For this purpose, in this study, a cDNA library was produced from the venom glands of this scorpion using the Illumina RNA sequencing technique. The coding sequences of PLA2 were identified and extracted using the basic local alignment search tool (BLAST) and similarity searches between raw venom gland data with sequences recorded from other arthropods, especially the scorpion Centruroides sculpturatus. These searches led to the discovery of several homologs of PLA2 in the venom glands of this scorpion with sequence similarity to platelet acetylhydrolase-activating factor (PAFA), calcium-dependent PLA2s (cPLA2), secreted PLA2s (sPLA2), calcium-independent PLA2s (iPLA2) and, group III heterodimeric phospholipase A2 (hgPLA2). Most of the found sequences showed the most similarity with the PLA2 sequences from scorpions of C. sculpturatus and Androctonus crassicauda. This report is one of the few transcriptome sequencing efforts to identify, classify and analyze the physicochemical properties of PLA2 sequences form venom gland of H. lepturus, in which the phylogenetic relationships between different arthropods were investigated using the identified sequences of the genus Hemiscorpius.
Keywords: Scorpion, Hemiscorpius Lepturus, Venom Gland, Phospholipase A2, Cdna Library, Phylogenetic Relationships -
نشریه تحقیقات دامپزشکی و فرآورده های بیولوژیک، سال سی و ششم شماره 2 (پیاپی 139، تابستان 1402)، صص 60 -70به کمک روش RNA-seq می توان اطلاعات کاملی در خصوص شناسایی ژن ها بدست آورد که نتایج آن ممکن است در ژنتیک و اصلاح دام و طیور سودمند باشد. تاکنون مطالعات کمی در خصوص استفاده از این روش در ارزیابی ترانسکریپتوم طیور بومی گزارش شده است، با توجه به اهمیت lncRNAها در فرآیندهای بیولوژیکی، در مطالعه حاضر به بررسی lncRNAهای حاصل از ترانسکریپتوم مرغ بومی اصفهان و سویه تجاری راس 708 و تفاوت بیان آن ها پرداخته شده است. در این مطالعه با استفاده از توالی یابی نسل جدید، 568 lncRNA شناسایی شد که تغییرات بیان 116 lncRNA معنی دار بود (05/0 P-value ≤ P-value). نتایج نشان داد lncRNA های دارای بیان متفاوت در مسیر های بیولوژیکی مرتبط با متیلاسیون لایزین و هیستون، فعال سازی لکوسیت های میلوییدی، تنظیم مثبت تولید سایتوکین و تنظیم فعال سازی لنفوسیت ها نقش دارند. آنالیز عملکرد مولکولی این ژن ها نشان داد فعالیت پروتیین تیروزین کیناز غیر غشایی، پروتیین متیل ترانسفراز، متیل ترانسفراز وابسته به S-آدنوزیل متیونین، و انتقال گروه های یک کربنی و اتصال گیرنده سیگنال به طور معنی داری غنی می شوند. بر اساس نتایج حاصل، lncRNAهایی که تفاوت بیان معنی داری در دو گروه بومی و تجاری دارند با مسیرهای سیستم ایمنی و متیلاسیون مرتبط می باشند که می توانند به عنوان بیومارکر استفاده شوند.کلید واژگان: الگوی بیان ژن, lncRNA, نژاد مرغ بومی, سویه راس, RNA-seqBased on the RNA-seq method, a thorough set of information can be obtained from the identification of geneswhich the results may be beneficial in the genetics and breeding of livestock and poultry. So far, few studies have been reported regarding the use of this method in the evaluation of native poultry transcriptome. Considering the importance of lncRNAs in biological processes, the present study has investigated the lncRNAs from the transcriptome of native Isfahan chicken and the commercial Ross 708 strain as well as differences in their expression. In this study using next generation sequencing, 568 lncRNAs were identified, out of which the expression changes of 116 lncRNAs were meaningful (P-value ≤0.05). The results showed differently-expressed incRNAs which are associated with the biological pathways including histone and lysine methylation, myeloid leukocyte activation, positive regulation of cytokine production ,, , and regulation of lymphocyte activation. The analysis of molecular functions of the genes indicated the activity of non-membrane-spanning tyrosine kinase, protein methyltransferase, S-adenosylmethionine-dependent methyltransferase, and transfer of one-carbon groupsacting on a protein, and signaling receptor binding are enhanced meaningfully. Based on the results, lncRNAs that vary in expression between native and commercial groups are associated with immune and methylation pathways, and can be used as biomarkers.Keywords: Gene expression pattern, lncRNA, Native chicken breed, Ross strain, RNA-seq
-
مصرف استروژن در زنان می تواند خطر ابتلا به سرطان سینه را افزایش دهد. استروژن رشد سلول های سرطانی را از طریق گیرنده استروژن آلفا تحریک می کند. یکی از استراتژی هایی که اخیرا مورد توجه قرار گرفته است، استفاده از فیتواستروژن ها است. مطالعات قبلی نشان داده است که گیاه ویتکس حاوی سطوح بالایی از فیتواستروژن است. در مورد این که آیا فیتواستروژن های موجود در گیاه ویتکس برای اتصال کدام گیرنده (استروژن آلفا یا بتا) را انتخابی می کنند اختلاف نظر وجود دارد. با در نظر گرفتن این موضوع که در اوویداکت مرغ تخم گذار تنها گیرنده استروژن آلفا حضور دارد، در این آزمایش از مرغ های تخم گذار به عنوان مدل برای یافتن پاسخ استفاده شد. در این مطالعه اثر پودر میوه ویتکس بر عملکرد، کیفیت تخم مرغ، پاسخ ایمنی و بیان ژن های GnRH، LH، اوومویید و اووآلبومین در مرغ های تخم گذار بررسی شد. تعداد 90 قطعه مرغ تخم گذار لگهورن (Hy-Line, W-36) در سن (72 تا 80 هفتگی) در قالب طرح کاملا تصادفی با سه تیمار و پنج تکرار مورد استفاده قرار گرفت. تیمارها سطوح مختلف پودر میوه ویتکس شامل سطوح صفر، 1 و 2 درصد پودر میوه ویتکس به ازای هر کیلوگرم جیره بودند. نتایج تحقیق حاضر نشان داد که پارامترهای عملکرد، کیفیت تخم مرغ و پاسخ های ایمنی تحت تاثیر سطوح مختلف پودر میوه ویتکس قرار نگرفتند. نتایج واکنش زنجیره ای پلیمراز در زمان واقعی نشان داد که سطوح مختلف پودر میوه ویتکس تاثیر معنی داری بر بیان ژن های LH، اوومویید و اووآلبومین ندارد. با این حال، بیان ژن GnRH در تیمار 3 (جیره غذایی حاوی 2 درصد ویتکس نسبت به گروه شاهد و 1 درصد ویتکس به طور قابل توجهی افزایش یافت. علاوه بر این، افزودن 1 درصد پودر میوه ویتکس به جیره تاثیر معنی داری بر بیان ژن GnRH نداشت. در نتیجه، مصرف مکمل میوه ویتکس در مرغ های تخم گذار توصیه نمی شود. علاوه بر این، داده های ما این نظریه را تقویت می کند که فیتواستروژن های موجود در میوه های ویتکس، گیرنده استروژن بتا را برای اتصال یافتن انتخاب می کند.
کلید واژگان: ویتکس, بیان ژن, گیرنده استروژن, سرطانEstrogen consumption in women can increase the risk of breast cancer. Estrogen stimulates the growth of cancer cells through the estrogen receptor alpha (ERα). One of the strategies that has recently been considered is the use of phytoestrogens. Previous studies have shown that Chaste-berry contains high levels of phytoestrogens. Scientists disagree on whether the phytoestrogens in Chaste-berry are used to treat many diseases in women, which are ERα or ERβ selective. In the present study, laying hens were used as a model to find the answer because only alpha estrogen receptor is expressed in the oviduct. In this study, the effect of Chaste-berry fruit powder on performance, egg quality, immune response, and the expression of GnRH, LH, ovalbumin (OVAL), and ovomucoid (OVM) genes in laying hens were evaluated. A total of 90 leghorns (Hy-Line, W-36) laying hens (at 72 to 80 weeks old) were used in a completely randomized design with three treatments and five replicates (n=6). The treatments were various levels of Chaste-berry fruit powder including zero, 1, and 2% levels of Chaste-berry fruit powder per kg of diet. Our results showed that performance parameters, egg quality factors, and immune responses were not significantly affected by various levels of Chaste-berry fruit powder. Moreover, the results indicated that the various levels of Chaste-berry did not have a significant effect on LH, OVAL, and OVM gene expression. However, GnRH gene expression was significantly increased in treatment 3 (a diet containing 2% Chaste-berry) compared to the control and 1% Chaste-berry groups. Moreover, the addition of 1% Chaste-berry fruit powder to the diet had no significant effect on GnRH gene expression. Therefore, Chaste-berry supplementation is not recommended in laying hens. Furthermore, our data reinforce this theory that phytoestrogens in Chaste-berry fruits are ERβ-selective.
Keywords: Chaste-berry, Estrogen Receptor, Phytoestrogen, cancer -
مقدمه و هدف
فیتواستروژن ها، استروژن های گیاهی با عملکرد و ساختار استروژن هستند. استروژن در فرآیند سنتز پروتیین های سفیده تخم مرغ در مجرای اویداکت مرغ نقش مهمی ایفا می کند. گیاه پنج انگشت یک گیاه بومی کشورهای آسیای میانه، مرکزی، جنوب اروپا و کشورهای مدیترانه است. این گیاه در طب سنتی کاربردهای متعددی دارد. مطالعات قبلی نشان داده است که گیاه پنج انگشت حاوی سطوح بالایی از فیتواستروژن است. فعال ترین فیتواستروژن ها در پنج انگشت شامل آپیژنین، وایتکسین و پندولتین است. تاکنون مطالعه ای در مورد اثر فیتواستروژن های گیاه پنج انگشت بر بیان نشانگرهای ژنی اوویداکت (اووآلبومین و اوومویید) مرغ تخمگذار منتشر نشده است. از این رو، این مطالعه به منظور بررسی تاثیر میوه های گیاه پنج انگشت بر بیان ژن های اووآلبومین و اوومویید اویداکت مرغ های تخم گذار انجام شد.
مواد و روش هاتعداد 90 قطعه مرغ تخم گذار لگهورن (Hy-Line, W-36) در چرخه دوم تولید (در سن 72 تا 80 هفتگی) در قالب طرح کاملا تصادفی با سه تیمار، پنج تکرار و 6 قطعه مرغ در هر تکرار مورد استفاده قرار گرفت. تیمارها شامل سطوح مختلف پودر میوه پنج انگشت شامل سطوح صفر، 1 و 2 درصد پودر میوه پنج انگشت به ازای هر کیلوگرم جیره بودند. پس از استخراج RNAی کل، کیفیت RNA با استفاده از نانودراپ و الکتروفورز ژل آگارز مورد بررسی قرار گرفت و با استفاده از کیت سیناکلون cDNA سنتز شد. میزان بیان ژن با استفاده از تکنیک واکنش زنجیره ای پلیمراز در زمان واقعی اندازه گیری شد. در این روش از ژن بتااکتین به عنوان ژن مرجع جهت نرمال نمودن داده ها استفاده شد. برای تایید اختصاصیت هر پرایمر نمودار ذوب آن مورد بررسی قرار گرفت.
یافته هاالکتروفورز ژل آگارز محصولات واکنش زنجیره ای پلیمراز به ترتیب قطعات 60، 133 و 150 جفت باز را برای اووآلبومین، اوومویید و بتااکتین نشان داد. همه نمودارهای ذوب دارای یک پیک بودند که نشان دهنده حداقل دایمر پرایمر و اختصاصیت پرایمرها برای هر ژن بود. نتایج واکنش زنجیره ای پلیمراز در زمان واقعی نشان داد که مکمل سازی میوه پنج انگشت در سطوح 1 و 2 به جیره مرغ های تخمگذار تاثیری بر بیان ژن های اووآلبومین و اوومویید مرغ تخمگذار ندارد.
نتیجه گیریانتظار نمی رود که افزودن پودر میوه پنج انگشت به جیره مرغ های تخمگذار سبب افزایش تولید در مرغ تخمگذار شود. بنابراین افزودن گیاه پنج انگشت به جیره مرغ های تخمگذار پیشنهاد نمی شود.
کلید واژگان: اووآلبومین, بیان ژن, مرغ تخمگذار, وایتکسIntroduction and ObjectivePhytoestrogens are herbal estrogens with estrogen-like functions and structures. The estrogen hormone has an important role in the process of the synthesis of egg white proteins in the avian oviduct. Vitex agnus-castus (VAC) is a native plant of the middle Asian, southern European, and Mediterranean countries. This plant has numerous uses in traditional medicine and is traditionally used to treat many diseases in women. Previous studies have shown that VAC contains high levels of phytoestrogens. VAC consists of compounds such as vitexin, apigenin, and pendoltin, which are the most active phytoestrogen in VAC fruits. No study has been published so far on the effect of VAC on oviduct markers gene expression (ovalbumin (OVAL) and ovomucoid (OVM)). Hence, this study was performed to evaluate the effect of VAC fruits on gene expression for two oviduct markers OVAL and OVM of laying hens.
Material and MethodsA total of 90 leghorns (Hy-Line, W-36) laying hens on the second cycle of production (at 72 to 80 weeks old) were used in a completely randomized design with three treatments, five replicates and six hens per replivate. The treatments were various levels of VAC fruit powder including zero, 1, and 2% levels of VAC fruit powder per kg of diet. After extraction of total RNA, RNA quality was evaluated using Nanodrop and agarose gel electrophoresis and cDNA was synthesized using a Sinaclone kit. Eventually, gene expression was measured by the real-time qPCR method. In this method, 𝜷-actin gene was used as a reference gene to normalize the gene expression data. To confirm the specificity of each primer, its melting curves were examined.
ResultsElectrophoresis of the PCR products showed the 60, 133, and 150-bp fragments for OVAL, OVM, and Beta-actin, respectively. Melting peaks analysis on the PCR products for all primers confirmed minimal primer-dimers and primer specificity. The results of the real-time qPCR method indicated that supplementation of VAC fruits powder at levels 1 and 2 to the diet of laying hens has no effect on the expression of OVAL and OVM genes of laying hens in the second production cycle.
ConclusionTherefore, Adding VAC fruit powder to the diet of laying hens is not expected to increase egg production in laying hens. Therefore, VAC supplementation is not recommended to the diet of laying hens.
Keywords: Gene expression, Hens, Ovalbumin, Vitex -
ژن Mx نقش مهمی در پاسخ های ضد ویروسی مرغ دارد. ژن Mx یک کاندید بالقوه به عنوان یک نشانگر ژنتیکی مقاوم به ویروس آنفولانزا در مرغ می باشد. پژوهش حاضر به منظور بررسی چندشکلی ژن مقاومت به میکسوویروس (Mx) با استفاده از روش PCR-RFLP در مرغ بومی خوزستان انجام گرفت. به طور تصادفی از 100 قطعه مرغ بومی خوزستان از شهرهای (ملاثانی، اندیمشک، شوش) خون گیری شد و استخراج DNA از نمونه ها انجام شد. واکنش زنجیرهای پلیمراز (PCR) برای تکثیر قطعه 299 جفت بازی ژن مقاومت به میگزو ویروس (Mx) به کمک آغازگرهای اختصاصی صورت گرفت. قطعه تکثیر شده به وسیله آنزیم برشی HPY8l هضم گردید. فراوانی آللهایA و G در مرغان بومی شوش به ترتیب 54/0 و 46/0 ، در ملاثانی 85/0 و 15/0و در اندیمشک 57/0 و 47/0 و فراوانی ژنوتیپهای AA، GG و AG به ترتیب در شوش 40/0، 33/0 و 27/0، در ملاثانی 8/0، 1/0 و 1/0 و در اندیمشک 45/0، 40/0 و 15/0 بود. نتایج نشان داد که فراوانی آلل A بیشتر از G است بعلاوه، هتروزیگوسیتی مشاهده شده و تعداد آلل موثر نشان داد که میزان تنوع این جایگاه ها در جمعیت پایین است. با استفاده از آزمون کای مربع (X2) مشخص شد که فراوانی آللها در این جایگاه ژنی در حالت تعادل هاردی - وینبرگ نمیباشد. نتایج این تحقیق پیشنهاد می داد که ژن MX دارای چندشکلی است و پتانسیل بالایی برای استفاده به عنوان نشانگر ژنتیکی برای مقاومت در برابر آنفولانزای مرغی و بیماری نیوکاسل دارد.
کلید واژگان: ژن مقاومت به میکسوویروس (MX), آنفولانزا, مرغ بومی و چندشکلیThe myxovirus (Mx) gene play a crucial role in the antiviral responses of chicken. The Mx gene is a potential candidate as a genetic resistance marker to the avian influenza virus in chickens. This study was conducted to determine the polymorphism of myxovirus gene polymorphism using PCR-RFLP method in Khuzestan native chicken. In this research, blood samples were collected randomly from 100 Khuzestan native chicken (Malasani, Andimeshk and Shush) and DNA were extracted. Polymerase chain reaction (PCR) was used to amplify 299bp fragments of myxovirus (Mx) gene by specific primers. Then, the amplified fragment was digested with HPY8l enzyme. Allele frequency for A and G, in Shoosh 0.54 and 0.46, Mollasani 0.85 and 0.15 and Andimeshk 0.57 and 0.47 and genotype frequencies of AA, GG and AG, in Shoosh 0.40, 0.33 and 0.27, Mollasani 0.8, 0.1 and 0.1 and Andimeshk 0.45, 0.40 and 0.15 were achieved, respectively. The results showed that the frequency of allele A was higher than G. Furthermore, the observed heterozygosity and the effective number of alleles demonstrated low diversity in the population. Chi-square (X2) analysis showed that the locus allele frequencies are not in Hardy-Weinberg equilibrium. The results of this study suggested that the MX gene had polymorphism and had a high potential for use as a genetic marker for resistance to avian influenza and Newcastle disease.
Keywords: Mx gene, Native chicken, Avian Influenza, Polymorphism -
در این تحقیق به منظور تعیین بهترین تابع توصیف کننده ی منحنی شیردهی شکم اول در گاو نجدی خوزستان از رکوردهای روزآزمون تولید شیر که طی سال های 1369 تا 1392 توسط ایستگاه پشتیبانی گاو نجدی شهرستان شوشتر، جمع آوری شده بود، استفاده شد. رکوردها شامل 2369 داده مربوط به 444 گاو شکم اول بودند. برای تعیین بهترین تابع؛ شش تابع گامای ناقص، ویلمینک، تابع چندجمله ای معکوس، تابع لگاریتمی مختلط، تابع کبی ولی دو و تابع رگرسیون چندجمله ای مورد ارزیابی قرار گرفتند. تمام توابع با استفاده از رویه ی PROC NLIN و روش تکرار گاوس نیوتن نرم افزار SAS با رکوردهای روزآزمون تولید شیر برازش داده شدند و سپس نکویی برازش براساس معیارهای ضریب تبیینR2، ضریب تبیین تصحیح شده، میانگین مربعات خطا و ضریب آکاییک با هم مقایسه شدند. نتایج حاصل نشان داد که تابع چندجمله ای معکوس توصیف مناسب تری از منحنی شیردهی گاوهای نجدی ارایه داد. مقدار پارامتر های a، b، cبه ترتیب 4841/4، 2514/0، 00273/0، و وراثت پذیری آنها به ترتیب 120/0 ± 354/0، 11/0 ± 280/0 و 155/0 ± 276/0برآورد شدند. وراثت پذیری های ضرایب منحنی شیردهی در حد متوسط می باشند. لذا انتخاب بر اساس ضرایب مذکور می تواند منجر به پیشرفت ژنتیکی شود. ضمن اینکه به نظر می رسد با تصحیح اثرات محیطی شناخته شده می توان وراثت پذیری صفات مزبور را افزایش داد.کلید واژگان: تابع چندجمله ای معکوس, توابع توصیف کننده, وراثت پذیری و گاو نجدیTo determine the best function for describing lactation of Najdi cow in Khuzestan, the day-based milk production test records, collected by Shushtar support station from 1990 to 2014, were used. Records included 2369 data related to 444 first parity cows. To determine the best mathematical function, six functions includind incomplete gamma, wilmink, inverse polynomial, complex logarithmic, Cobby and Le Du, and polynomial regression were evaluated. All functions were fitted using PROC NLIN procedure of SAS software and Gauss-Newton iteration method on day-based milk production test records; and compared based on coefficient of determination R2, corrected coefficient of determination, the mean square error and Akaike index. The results showed that the inverse polynomial function offers a better description for lactation curve in Najdi cattle. The lactation curve parameters (a, b, c) were estimated 4.4841, 0.2514, 0.00273, and their heritability were 0.354±0.120, 0.280±0.11 and 0.276±0.155, respectively. Moderate heritability suggests the opportunity of genetic response via selection program. Heritability of these traits can be improved by correcting the known environmental impacts.Keywords: Description functions, Inverse polynomial function, Lactation Curve, Najdi cattle
-
مصرف بی رویه آنتی بیوتیک موجب مقاومت آنتیبیوتیکی و انتقال ژن های مقاوم آنتی بیوتیک ها از حیوان به میکروب های انسانی می شود، بنابراین باید جایگزین هایی را برای آن معرفی کرد که آزمایش حاضر با همین هدف انجام شده است. از 420 قطعه بلدرچین ژاپنی یک روزه به مدت 35 روز در قالب طرح کاملا تصادفی با 7 تیمار، 3 تکرار و 20 قطعه جوجه در هر تکرار استفاده شد. تیمارهای آزمایشی شامل جیرهی شاهد و سه سطح پروتکسین و ویرجینامایسین 10 درصد (25/0، 5/0 و 75/0 درصد) بودند. در کل دوره پرورش، مقدار خوراک مصرفی تحت تاثیر تیمارهای آزمایشی حاوی پروتکسین و ویرجینامایسین، نسبت به شاهد کاهش یافت (05/0>P). اثر پروتکسین بر وزن زنده، لاشه آماده طبخ و میانگین افزایش وزن روزانه معنی دار بود، به طوری که در تیمارهای حاوی پروتکسین وزن زنده و لاشه آماده طبخ بالاتر از شاهد بود (05/0>P). تیمار حاوی 25/0 درصد پروتکسین بالاترین وزن زنده و وزن لاشه آماده طبخ را داشت (05/0>P). غلظت فرآسنجه های خونی گلوکز، کلسترول، تریگلیسرید، لیپوپروتیین های با دانسیته بالا، پایین و بسیار پایین و نیتروژن اوره ای خون تحت تاثیر قرارگرفتند (05/0>P). کل کلونی های میکروارگانیسمی در جیره حاوی 75/0 درصد پروتکسین یا 5/0 درصد ویرجینامایسین بالاتر از شاهد بود (05/0>P). جیره های حاوی پروتکسین و ویرجینامایسین منجر به افزایش تعداد کلونیهای باکتریهای مفید، کاهش ایکولای، حذف سالمونلا و افزایش ارتفاع، عرض و عمق کریپت پرزهای ایلیوم و ژژنوم نسبت به شاهد شدند (05/0>P)، بنابراین اثر پروبیوتیک نه تنها با آنتی بیوتیک برابری کرد، بلکه در مواردی اثرات بهتر و مفیدتری نیز داشت، پس می توان استفاده از پروبیوتیک پروتکسین را به جای آنتی بیوتیک ویرجینامایسین در جیره پیشنهاد کرد.کلید واژگان: ایکولای, بلدرچین ژاپنی, پرزهای روده, پروتکسین, سالمونلاIndiscriminate use of antibiotics promotes the development of antibiotic resistance and transfer of antibiotic resistance genes from animal to human microbes, Therefore, alternatives should be introduced. This experiment was conducted to this purpose. The 420 one-day-old Japanese quail randomly were allocated in seven experimental treatments, 3 replicate and 20 quail per replicate. The experimental treatments were control diet, and three level from the protexin and virginiamycin (0.25, 0.50 and 0.75%). Compared with control feed intake was reduced by fed treatments containing protexin and virginiamycin in whole period of experiment (P<0.05). The effect of protexin on live and carcass weight and average daily gain was significant; as live body and carcass weight in protexin group was more than control (P<0.05). The diet containing 0.25% protexin had the highest live and carcass weight. The concentration of all measured blood parameters, excepted for IgA and IgG, affected by protexin and virginiamycin in the diet (P<0.05). The whole colonies of microorganisms, in diet contained 75% protexin or 5% virginiamycin were higher than the control (P>0.05). The Supplemental protexin and virginiamycin resulted to increased the colonies of beneficial bacteria, reduced the population of Escherichia coli, removing of salmonella and increased of the height, width and crypt depth of ileum and jejunum villi in compared to the control. Therefore, the effects of probiotics were matched not only with the effects of antibiotics, but in some cases also had advantages. Therefore, the use of probiotics as an alternative to antibiotics may be recommendable in the diet of birds.Keywords: E.coli, Intestinal villi, Japanese quail, Protexin, Salmonella
-
زمینه مطالعاتی
شناسایی متغیرهای موثر بر صفات کمی در اصلاح نژاد دام اهمیت بالایی دارد.
هدفدر این پژوهش توانایی سه روش مطالعه پویش کل ژنوم بر اساس تک- چند شکلی تک نوکلیوتیدی یا SSGWAS، مکان یابی وراثت پذیری ناحیه ای (RHM) و آزمون پویش سریع مبتنی بر سطح بندی (fastBAT) برای شناسایی متغیرهای ژنتیکی موثر بر صفات کمی، مورد بررسی قرار گرفته است.
روش کاریک جمعیت گاوی با اندازه 4040 راس دام شبیه سازی شد. برای این جمعیت 3 جفت کروموزم غیر جنسی با تعداد 27586 چند شکلی تک نوکلیوتیدی برای هر کروموزم در نظر گرفته شد. شبیه سازی در قالب 3 سناریو با تعداد 75، 150 و 300 جایگاه صفت کمی و با در نظر گرفتن 10 تکرار برای هر سناریو انجام شد. در بررسی متغیرها ماتریس های روابط کل ژنوم و روابط ژنتیکی مبتنی بر شجره در مدل مورد استفاده قرار گرفت. برای مقایسه توانایی روش ها در شناسایی QTL ها از معیار تعداد SNP های معنی دار در مجاورت با QTL ها استفاده گردید.
نتایجاز مجموع 30 تکرار شبیه سازی شده، در روش SSGWAS تعداد 16 QTL شناسایی شد که 2 QTL دارای فراوانی آلل نادر یا MAF کوچکتر یا مساوی 1/0 بوده و سایر QTL ها با MAF بالاتر از 1/0 شناسایی شدند. در روش fastBAT 107 ناحیه معنی دار شناسایی شد که همه این نواحی حاوی QTL شبیه سازی شده بود. در این روش تعداد 120 QTL در 3 سناریو شناسایی شد که تعداد 52 QTL با MAF کوچکتر یا مساوی 1/0 شناسایی شدند. همه QTL های شناسایی شده در دو روش fastBAT و SSGWAS در روش RHM نیز شناسایی شد. در RHM تعداد 612 ناحیه معنی دار شناسایی شد که همه این نواحی حاوی QTL شبیه سازی شده بودند. در این روش تعداد 316 QTL با MAF کوچکتر یا مساوی 1/0 شناسایی شد.
نتیجه گیری نهایینتایج این بررسی نشان می دهد که روش RHM قابلیت بالاتری نسبت به دو روش دیگر در شناسایی QTL های موثر بر واریانس صفت کمی دارد.
کلید واژگان: جایگاه صفات کمی, چند شکلی تک نوکلئوتیدی, شبیه سازی, مطالعه پویش کل ژنومIntroductionDue to the widespread distribution of SNPs throughout the genome, these markers are widely used in livestock breeding research. These markers were used to predict the disease risk in human, to localize genetic variations responsible for complex traits through genome wide association study (GWAS), and to predict the genetic values of economically important traits in plant and animal breeding (Zhang et al 2015). Mostly whole genome scanning methods are based on two SSGWAS (Single SNP Genome-Wide Association Studies) and multiple markers methods. The SSGWAS method is able to identify a large number of common variables affecting quantitative traits. However, a large proportion of the genetic variance remains to be explained (Shirali et al 2018). In quantitative traits the proportion of phenotypic variance explained by SNPs is related to the number of adjacent SNPs in the genomic region. The heritability created by these genomic regions is defined as the regional heritability. The RHM (Regional Heritability Mapping) method is used to identify small genomic regions. This method can capture more of the missing genetic variation (Nagamine et al 2012). In RHM, a mixed model framework based on Restricted Maximum Likelihood (REML) is used, and two variance components, one contributed by the whole genome and a second one by a specific genomic region, are fitted in the model to estimate genomic and regional heritabilities, respectively (Uemoto et al 2013). Also fastBAT (fast and flexible set-Based Association Test) is a method that performs a fast set-based association analysis (Bakshi et al 2016). The purpose of this study is compare SNPs and regions identified by the Genome-Wide Association methods, compare these results with the simulated QTLs and also investigate and determine the false positive results in each method.
Material and methodsIn this study, markers and populations were simulated as a Forward-in-time process using QMSim software (Sargolzaei and Schenkel 2009). For this population, 27586 single nucleotide polymorphisms (SNPs) were counted on 3 pairs of autosomal chromosomes. Simulation was performed in 3 scenarios with 75, 150 and 300 quantitative trait loci (QTL). The minimum and maximum number of SNPs in the analysis after quality control were 19662 and 23817 SNPs, respectively. For each scenario, 10 replicates were simulated, in all scenarios, heritability was 0.2 which corresponded equally to the polygenic and QTLs effects. Whole genomic relationship and pedigree base genetic relationship matrices were used in all 3 methods to estimate genetic parameters. To create the whole genomic relationships matrix, whole genomic additive effects was estimated using all SNPs. Also the additive effect of genomic regions was estimated using the regional genomic relationship matrix. Whole genomic relationships matrix and regional genomic relationship matrix were estimated based on genetic relationships between individuals using SNPs by GCTA software (Yang et al 2011). Pedigree based genetic relationship matrix was created by the kinship relationship between individuals using pedigree package (Coster 2013) of RStudio software (RStudio Inc 2013). To perform RHM and to estimate variance components, windows containing 50 genotyped SNPs were considered. Also windows containing 25 genotyped SNPs to overlap between two consecutive windows throughout the genome were used. SSGWAS analysis were performed by MLMA (Yu et al 2006) method using GCTA software. MLMA results were adjusted based on P-value at 5% significant threshold using Bonferroni correction. To evaluate the results of SSGWAS using fastBAT method, GCTA software was used.
Results and discussionFor each replication after identifying significant SNPs, the genetic variance explained by these SNPs was estimated by equation (Faulkner & McKay 1996). In Table 1, the number of QTLs detected by the SSGWAS method, the MAF of QTLs, the range and mean of genetic variance explained by significant SNPs and QTLs are reported. For 30 replicates of simulation in SSGWAS, 16 QTLs were detected containing 2 QTLs with MAF≤0.1 and other detected QTLs with MAF≥0.1. 107 Significant regions were identified in fastBAT method. In this method, 120 QTLs were detected in 3 scenarios containing 52 QTLs with MAF≤0.1. All QTLs detected in the fastBAT and SSGWAS methods were also detected in the RHM method. In RHM method, 612 regions containing simulated QTLs and number of 316 QTLs with MAF≤0.1 were detected. In all replications, the variance explained by SNPs was equal to the variance explained by QTLs. In SSGWAS, less number of QTLs were detected than the other two methods and the maximum variance explained by QTLs was 14.9%. The criterion used to determine false positive QTLs was the absence of significant QTL in the before and after significant windows containing QTLs. In SSGWAS method the percentage of false positive QTLs was higher than the other two methods. In fastBAT, unlike the other two methods, detected QTLs were not false positive. In table 5 Number of detected QTLs, MAF range of QTLs, range and mean of genetic variance explained by detected QTLs and SNPs in fastBAT are shown. Many QTLs and regions detected by RHM method were not detected by SSGWAS and fastBAT methods. The genetic variance explained by detected QTLs in the RHM was at the range of 7.26 to 46.86% that was higher than other two methods. In table 6 the three methods compared by the number of detected QTLs, number of false positive QTLs, number of stable QTLs and the number of detected QTLs with MAF≤0.1. We found that QTLs with MAF≤0.1 were more frequently detected in RHM than the other two methods. These results confirmed that the RHM method was able to identifying more of QTLs affecting the trait variance.
Keywords: Quantitative traits locus, Single nucleotide polymorphism, Simulation, Whole genome scanning studies -
هدف از انجام این مطالعه، برآورد مقدار ضریب درون زادآوری و ارزیابی اثر آن بر صفات رشد، در گوسفندان مغانی بود. در این پژوهش، از رکوردهای مربوط به 7278 راس بره حاصل از 387 راس قوچ و 2433 راس میش که طی سال های 1374 تا 1389 در ایستگاه جعفرآباد مغان، جمع آوری شده بود، استفاده شد. برای برآورد ضریب مزبور و گروه های مختلف هم خونی از برنامه CFC استفاده شد. 1019 راس از کل حیوانات شجره، هم خون بودند. میانگین ضریب درون زادآوری برای کل جمعیت و جمعیت هم خون به ترتیب برابر 6/0 و 4/4 درصد برآورد شد. بیش ترین مقدار هم خونی 1/6 درصد و بیش ترین حیوانات هم خون را حیوانات با ضریب درون زادآوری صفر تا 5 درصد تشکیل دادند که این نتایج در حال حاضر میزان پایین هم خونی در این گله را تایید می کند. روند تغییرات سالانه تبارآمیزی برای کل جمعیت 0006/0± 0014/0 درصد و از لحاظ آماری معنی دار بود (01/0P<). روند تغییرات سالانه تبارآمیزی برای حیوانات هم خون برابر 0026/0± 0047/0- درصد بوده که از لحاظ آماری معنی دار نبود. ضریب تابعیت صفات اوزان تولد، شیرگیری، شش ماهگی، نه ماهگی و یک سالگی از هم خونی به ترتیب برابر 046/0، 16/5، 04/1، 07/0 و 95/6- گرم محاسبه شد. با مدیریت هم خونی به صورت افزایش آمیزش های دور در گله و استفاده از آمیزش نرهای مولد برتر به صورت کنترل شده، می توان از اثرات زیان آور احتمالی، ناشی از افزایش بیش از حد هم خونی جلوگیری نمود.کلید واژگان: گوسفند مغانی, روند هم خونی و صفات رشدThe aim of the current study was to estimate inbreeding coefficient and Annual changes in Moghani sheep. In this research, records of 7278 lambs born from 387 rams and 2433 ewes were used. Data was collected from Jafarabad sheep breeding station in Moghan during 1995-2011. Estimating of inbreeding coefficient was done by CFC program. In total pedigree, 1019 animals were inbred. Averages of inbreeding coefficient for total and inbred population were estimated at 0.6 and 4.4 respectively. The highest inbreeding coefficient was 6.1 % and most inbred animals had inbreeding coefficients lower than 5 %. These results confirmed the low level of inbreeding in the population. Annual trend in inbreeding coefficient for total population were 0.0014±0.0006 and statistically significant (P<0.01). Annual trend in inbreeding coefficient for inbred population were -0.0047±0.0026 and not statistically significant. The regression of inbreeding for birth weight, weaning weight, 6 month weight, 9 month weight and 12 month weight traits were calculated +0.046, 5.16, 1.04, 0.07 and -6.95 gr respectively. Applying a designed mating system like crossbreeding and supervised using of elite rams could be a suitable method to avoid inbreeding depression via keeping the level of inbreeding under control.Keywords: Moghani Sheep, Inbreeding Trend, Growth Traits
-
ژن DMB2 یکی از ژن های خوشه MHC است که در پاسخ ایمنی همورال نقش ایفا می کند. این تحقیق جهت شناسایی چندشکلی ناحیه اگزون 2 ژن MHC-DMB2 و ارتباط آن با پاسخ ایمنی همورال در بلدرچین ژاپنی انجام گرفت. بدین منظور در روز 28 دوره پرورش، مقدار 2/0 میلی لیتر محلول پنج درصد گلبول قرمز خون گوسفندی (SRBC) به عضله سینه 130 بلدرچین ژاپنی (65 نر و 65 ماده) تزریق شد و هفت روز بعد در روز 35 دوره پرورش، خون گیری جهت تعیین تیتر آنتی بادی علیه SRBC انجام شد. DNA ژنومی از نمونههای خون استخراج شد و قطعهای به اندازه 333 جفت باز از این جایگاه با استفاده از واکنش زنجیرهای پلیمراز (PCR) تکثیر شده و محصولات PCR به وسیله آنزیم برشی Hinf I هضم شدند. نتایج حاصل حاکی از وجود دو نوع آلل C (333 جفت بازی) و آلل G (226 و 107 جفت بازی) در این جایگاه بود که فراوانی آنها در کل جمعیت به ترتیب 6/74 و 4/25 درصد محاسبه شد. نتایج نشان دهنده وجود چندشکلی و میزان هموزیگوسیتی بالا در جمعیت مورد مطالعه است. به علاوه، نتایج نشان داد که ژنوتیپ اثر معنی داری بر تیتر آنتی بادی دارد (01/0 <p). ژنوتیپ CC بیشترین (13/2 میلی گرم بر دسی لیتر) و ژنوتیپ GG کمترین تیتر آنتی بادی کل (33/0 میلی گرم بر دسی لیتر) را نشان داد. پیشنهاد می شود آثار منفی این چندشکلی تک نوکلیوتیدی در برنامه های اصلاح نژادی در نظر گرفته شود.
کلید واژگان: ایمنی همورال, بلدرچین ژاپنی, چندشکلی, ژن DMB2, PCR-RFLPThe DMB2 gene is one of the MHC cluster genes that plays a role in the humoral immune response. This study was performed to identify the polymorphism of exon 2 of the MHC-DMB2 gene and its association with the humoral immune response in Japanese quail. For this purpose, on day 28, 0.2 mL of 5% saline suspension of sheep red blood cell (SRBC) was injected into 130 quail's breast muscle (65 males and 65 females). Seven days later, cervical vein blood sampling was performed on the 35th day. Afterward, the anti-SRBC titer antibody was determined using a micro hemagglutination technique. Also, genomic DNA was extracted from blood samples and a 333bp fragment of exon 2 was amplified using polymerase chain reaction and PCR products were digested by Hinf 1 restriction enzyme. The results showed that there were two types of C (333bp) and G (226, 107bp) alleles in this region with a frequency of 74.6% and 26.4% in the whole population, respectively. The results indicate high polymorphism and high homozygosity in the studied population. In addition, the results showed that genotype had a significant effect on antibody titers (P<0.01). The CC genotype showed the highest total antibody titer (2.13 mg/dL) and the GG genotype showed the lowest total antibody titer (0.33 mg/dL). It is suggested that the negative effects of this single nucleotide polymorphism be considered in breeding programs.
Keywords: Humoral immunity, Japanese quail, Polymorphism, DMB2 gene, PCR-RFLP -
بهره وری اقتصادی پرورش گوسفند تا حد زیادی تحت تاثیر میزان زنده مانی آن است. هدف این مطالعه بررسی پارامترهای ژنتیکی صفات زنده مانی گوسفند عربی از تولد تا یکسالگی بود. بدین منظور از تعداد 5452 رکورد زنده مانی بره های نژاد عربی که طی سال های1371 تا 1383 توسط سازمان جهاد کشاورزی شهرستان اهواز جمع آوری شده بود استفاده گردید. داده ها با مدل های خطی و نسبت خطر با تابع ویبال تجزیه شدند. این مدل ها شامل اثر عوامل ثابت سال و ماه تولد بره، نوع تولد، سن مادر و متغیر کمکی وزن تولد بره ها به صورت درجه دوم و اثرات تصادفی ژنتیکی افزایشی مستقیم، ژنتیکی افزایشی مادری، محیط دایمی مادری و باقی مانده بودند. وراثت پذیری مستقیم میزان زنده مانی بره ها با مدل های مختلف خطی، در بازه 025/0 تا 061/0 برآورد گردید. وراثت پذیری های مستقیم در مقیاس لگاریتمی، مقیاس اولیه و وراثت پذیری موثر نسبت خطر به دست آمده از مدل پدری دارای تابع ویبال دامنه 13/0 تا 75/0 را نشان داد. نتایج بیانگر وراثت پذیری کم برای مدل های خطی و متوسط تا بالا برای تابع ویبال بود. تخمین های متوسط تا بالای وراثت پذیری صفات بقا، با استفاده از مدل های نسبت خطر با تابع ویبال، می تواند ایده بهبود بقای بره از طریق انتخاب درون نژادی و گنجاندن آن در شاخص انتخاب نژاد گوسفند عربی را مورد توجه قرار دهد.
کلید واژگان: زنده مانی, گوسفند عربی, وراثت پذیریIntroductionArabi sheep population includes almost 55% of the local sheep population in Khuzestan province. Lamb mortality is a universal problem in sheep breeding that may be reached to 20-40% of total lambs born and could impact the genetic improvement, animal welfare and economic viability of sheep breeding, adversely. Research on improving survival of lambs is likely to have a higher pay-off than research on improving the number of lambs conceived. Lamb survival is a compound trait affected by many various factors related to climate, management, lamb and ewe behavior and genetic effects. Lamb survivability is controlled by genetics of the animal, contributed by direct genetic and maternal effects and also by environmental effects. There are disagreements among researchers about using a suitable model to analyze the survival traits, and each researcher has suggested the use of specific models. In general, the use of linear and threshold models has been suggested for survival trait analysis. Although survival has great economic importance, in the studies conducted on Iranian livestock, less attention has been paid to it. The aim of this study was to analyze the genetic parameters for the survival of Arabi lambs from birth to one year of age using linear and Weibull models.
Materials and Methodsin this study, 5452 lamb survival records collected by the Jahad Agricultural Organization of Ahvaz from 1993 to 2005 were used. Traits included were cumulative survival from birth to the end of one year and on a monthly basis. In order to estimate genetic parameters using linear models, the Restricted Maximum Likelihood (REML) method was used in Wombat software based on a univariate analysis. The Weibull model and Matvec software were also used for estimating variance component and genetic parameters of Survival rate.
Results and DiscussionDifferent models compared using the likelihood ratio test. For survival traits until 1, 4, 5, and 10 months, the model 4 was suitable, which include the direct additive genetic effect, maternal additive genetic effect and their covariance. In the case of until 2 months, the best model was the model 3, which include the direct and maternal additive genetic effects. For until 3, 8, 9, and 12 months, model 1 including direct additive genetic effect was selected. And for other traits Model 5 (direct additive genetic, maternal additive genetic, and maternal permanent environmental effects) was chosen as the best model. The direct heritability of survival rate estimated from different linear models was in the range of 0.025 to 0.061. In general, despite the high economic importance of survival in the breeds until one year of age, due to low estimates of the inheritance of these traits using linear models, it cannot be expected that genetic selection alone can make significant genetic progress. The genetic variance component among sires, heritability on the logarithmic scale, heritability on the original scale, and effective heritability obtained from Weibull sire model were increased to a peak point at 4 months. After that, a decline occurred until 5 months, and then a fluctuation was observed until 9 months. A limited increase was found in the 11 and 12 months. The heritability of sire model, in the logarithmic scale, had a low to medium range (0.13-0.25), and in the original scale had a medium to high range (0.39-0.75). The effective heritability was estimated in the medium range. Estimated values of the survival heritability using the Weibull model was greater than the value obtained from the linear animal model. Although heritability estimations for survival and mortality is low, it is possible that genetic progress may be enhanced by selecting lambs with higher breeding value for survival.
ConclusionEstimation of the genetic parameters for survival lambs from birth to one year of age using linear and Weibull models were low vs medium to high, respectively. Therefore, based on the results of linear models, response to direct selection to improve the survival of lambs in this breed will be very slow, and more attention should be paid to improving non-genetic factors and indirect selection and outbreeding, but based on The results of Weibull models, it seems that the rate of response to genetic selection to improve survival trait is faster using these models compared to the linear models, suggest that lamb survival could be improved through direct selection and could be included in the Arabi sheep selection index.
Keywords: Arabi sheep, Heritability, Survival -
هورمون آزادکننده گنادوتروپین ها (GnRH) یک مولکول تنظیم کننده کلیدی در محور هیپوفیز-هیپوتالاموس است که رونویسی هورمون لوتیینه کننده (LH) در هیپوفیز را القاء می کند. تحقیقات نشان داده که استروژن نقش مهمی در تنظیم GnRH ایفا می کند. همچنین آزمایشات اخیر نشان داده که گیاه پنج انگشت حاوی مقدار زیادی فیتواستروژن است. از این رو، در مطالعه حاضر به بررسی اثر پودر میوه گیاه پنج انگشت بر بیان ژن GnRH و LH در مرغان تخمگذار با استفاده از تکنیک Real time qPCR پرداخته شد. برای انجام این آزمایش از 90 قطعه مرغ تخمگذار سویه تجاری های لاین (W-36) از سن 72 تا 80 هفتگی در قالب یک طرح کاملا تصادفی با 3 تیمار، 5 تکرار و 6 قطعه مرغ در هر تکرار به مدت 56 روز استفاده شد. سه تیمار آزمایشی عبارت بودند از: 1- جیره شاهد (جیره پایه بدون هیچ افزودنی)، 2- جیره پایه به همراه 1 درصد پودر میوه گیاه پنج انگشت، 3- جیره پایه به همراه 2 درصد پودر میوه گیاه پنج انگشت. در انتهای آزمایش یک مرغ از هر تکرار کشتار شد، هیپوتالاموس آن ها جدا و به آزمایشگاه منتقل گردید. سپس RNA استخراج شده و برای سنتز cDNA مورد استفاده قرار گرفت. نتایج تجزیه واریانس نشان داد بیان ژن GnRH در تیمار 3 (جیره حاوی 2 درصد پودر میوه گیاه پنج انگشت) نسبت به شاهد و تیمار 1 درصد افزایش معنی داری داشت (0/01>p)، در حالی که افزودن پودر میوه گیاه پنج انگشت به میزان 1 درصد تآثیر معنی داری بر بیان ژن GnRH نداشت (0/05 < p). علاوه براین افزودن 1 و 2 درصد پودر میوه گیاه پنج انگشت تاثیر معنی داری بر بیان ژن LH نداشت (0/05 < p). نتایج این تحقیق نشان داد که افزودن پودر میوه گیاه پنج انگشت به میزان 2 درصد نمی تواند بر محور هیپوفیز-هیپوتالاموس مرغ تخمگذار در سنین 72 تا 80 هفتگی تاثیرگذار باشد.
کلید واژگان: بیان ژن, فیتواستروژن, گیاه پنج انگشت, GnRHGonadotropin-releasing hormone (GnRH) is a key regulatory molecule of the hypothalamus–pituitary gonadal axis which induces transcription of luteinizing hormone (LH) from the anterior pituitary. Research has shown that estrogen plays an important role in regulating GnRH. Also, recent experiments indicated that Vitex agnus-castus (VAC) has high levels of phytoestrogen. Hence, this research was performed to investigate the effect of Vitex Agnuse Castus (VAC) fruit powder on GnRH and LH genes expression in laying hens using Real time qPCR technique. For this purpose, 90 Hy-line W-36 leghorn (at 72 to 80 weeks old) were used in a completely randomized design with 3 treatments, 5 replicates and 6 hens per replicate for 56 days as an experimental period. The three experimental treatments were: 1- control diet (basal diet without any additives), 2- basal diet plus 1% VAC fruit powder, 3- Basal diet plus 2% VAC fruit powder. At the end of the experiment one hens were slaughtered and their hypothalamus was rapidly separated and transferred to the laboratory with liquid nitrogen. Then, RNA was extracted and used for cDNA synthesis. Finally, GnRH gene expression was evaluated by Real-Time qPCR. The ANOVA results showed that GnRH gene expression was significantly increased in treatment 3 (diet containing 2% VAC) compared to the control and 1% VAC groups (P <0.01). While, addition of 1% VAC fruit powder to diet had no significant effect on GnRH gene expression (P> 0.05). Furthermore, addition of 1 or 2 % VOC fruit powder had no significant effect on LH gene expression (P> 0.05). The results of this study showed that the addition of VOC fruit powder fruit powder up to 2% level could not affect the pituitary-hypothalamic axis of laying hens at 72 to 80 weeks old.
Keywords: GnRH, Gene expression, Phytoestrogen, Vitex Agnuse Castus -
بزها گونه های اهلی با سازگاری بالا هستند و به عنوان سرمایه های ژنتیکی برای بشر در سراسر دنیا مطرح می باشند. محافظت و شناسایی تنوع ژنتیکی در این جمعیت ها بدلیل خطر کاهش شدید، لازم و ضروری است. بز عدنی جزء دام های شیری سازگار با مناطق گرمسیری در کشور محسوب می شودکه در معرض خطر انقراض قرار دارد. لذا این آزمایش به منظور تجزیه وتحلیل ژنتیکی و بررسی روابط فیلوژنتیکی و شناسایی منشا مادری این جمعیت با اسفاده از توالی ناحیه HVR1 ژنوم میتوکندری انجام شد. برای رسیدن به این هدف، از 12 راس بز عدنی از استان بوشهر خونگیری انجام گردید. پس از استخراجDNA ، یک قطعه 968 جفت بازی توسط پرایمرهای اختصاصی با استفاده از روش PCR تکثیر و توالی یابی شد. نتایج تنوع ژنتیکی10 هاپلوتیپ بر اساس 42 جایگاه متفاوت را نشان داد. بعلاوه، تنوع هاپلوتیپی و نوکلیوتیدی بترتیب برابر 954/0 و0123/0 به دست آمد. این نتایج نشاندهنده تنوع ژنتیکی بالا در بز عدنی است. نتایج فیلوژنتیکی با استفاده از روش NJنشان داد که بز عدنی با نژاد عفار از کشور اتیوپی قرابت ژنتیکی بالایی دارد و در هاپلوگروپ A طبقه بندی می شود که دلیل آن می تواند موقعیت جغرافیایی استان بوشهر و واقع شدن آن در کنار خلیج فارس و دریای عمان باشد.
کلید واژگان: بز عدنی, ژنوم میتوکندری, فیلوژنتیک, HVR1Journal of Genetics, Volume:15 Issue: 4, 2021, PP 297 -304Goats are highly adapted domesticated species and are considered as genetic resources for human beings around the world. Protecting and identifying genetic diversity in goat populations is imperative because of the risk of a severe decline. The Adani dairy goat is one of the most important indigenous goat breeds of Iran and is reared in the coastal area of the Persian Gulf in Boushehr province. In spite of high temperatures, humidity and low quality and quantity pastures, the breed has been well adapted to the harsh environmental conditions. Considering the importance of conservation of indigenous breeds adapted to harsh environmental conditions, the objective of the current study was to determine the maternal line and the phylogenetic relationship Adani goat breed using hyper variable region 1 (HVR 1). For this purpose, blood samples were collected from 12 Adani goats of Bushehr province. After DNA extraction, a 968 base pair fragment was amplified by specific primers using the PCR method and sequenced. Analysis of HVR1 sequences showed 10 haplotypes with 42 different positions. Moreover, the haplotype and nucleotide diversity based on HVR1 region were estimated 0.954 and 0.0123, respectively. These results indicate high genetic variation in Adani goat. The phylogenetic tree pattern revealed that the Adani goat was clustered with Afar breed from Ethiopia and also, was classified into haplogroup A. This could be due to the geographical location of Bushehr province and its location next to the Persian Gulf and the Sea of Oman.
Keywords: Adani goat, mt DNA, Phylogenetic, HVR 1 -
در مطالعه حاضر برای شناسایی چند شکلی ناحیه اگزون 2 ژن MHC (مجتمع اصلی سازگاری بافتی) و ارتباط آن با صفات رشد (وزن تولد و سه ماهگی) در جمعیت بز عدنی، از تعداد 97 راس بزعدنی استان بوشهر خونگیری انجام گرفت. DNA ژنومی از نمونههای خون استخراج و قطعه ای به اندازه 279 جفت باز از ناحیه اگزون 2 ژن MHC با استفاده از واکنش زنجیرهای پلیمراز (PCR) تکثیر و محصولات PCR به دست آمده به وسیله آنزیم برشی Ras I هضم شدند. نتایج بدست آمده حاکی از وجود 4 نوع آلل A، B، C و D در این جایگاه بود که فراوانی آنها در کل جمعیت به ترتیب 51، 8/26، 4/13 و 8/8 درصد محاسبه شد. تعداد 5 ژنوتیپ AA، AB،BB ، AC و AD شناسایی شدند که فراوانی ژنوتیپی محاسبه شده آنها در جمعیت به ترتیب برابر 432/14، 866/28، 371/12، 80/26 و 52/17 درصد بود. نتایج نشان دهنده ی وجود چند شکلی و میزان هتروزیگوسیتی بالا در جمعیت مورد مطالعه ابود. تعداد آلل موثر، شاخص شانون، هتروزیگوسیتی موردانتظار و مشاهده شده برای این جایگاه به ترتیب 794/2، 179/1، 642/0 و732/0 محاسبه شد. بعلاوه، آزمون کای مربع نشان داد که جمعیت در جایگاه MHC-DRB1 در تعادل هاردی-وینبرگ قرار ندارد. نتایج نشان داد که تاثیر ژنوتیپ های مختلف بر وزن تولد معنی دار بود (05/0p<) اما بر وزن سه ماهگی معنی دار نبود (05/0< p). بعلاوه، سایر صفات مثل سن مادر، جنسیت، فصل و تیپ تولد روی هیچ کدام از صفات رشد بدن معنی دار نشد (05/0<p). بیشترین وزن تولد مربوط به ژنوتیپ های هتروزیگوت AC و AD (05/3 و 02/3 کیلوگرم) و کمترین وزن تولد مربوط به ژنوتیپ خالص AA (75/1 کیلوگرم) بود. به نظر میرسد با انتخاب ژنوتیپ AC و AD بتوان افزایش وزن تولد را در بز عدنی انتظار داشت. همچنین می توان از این ژن به عنوان یک ژن کاندیدا برای بهبود ژنتیکی برخی از صفات رشد در برنامه های اصلاح نژادی بز مورد توجه قرار گیرد.
کلید واژگان: چند شکلی, ژنMHC, بز عدنی, PCR-RFLPIn the present study, blood samples were collected from 97 Adani goat from Bushehr province in order to identify the polymorphism in the exon II region of MHC-DRB1 gene (Major Histocompatibility Complex) and also, its association with growth traits (birth weight and 3 months weight). Genomic DNA was extracted from blood samples. A 279-bp fragment was amplified using polymerase chain reaction (PCR). Eventually, the PCR products were digested by RasI enzyme. The results showed that there were 4 types of alleles A, B, C and D in this locus with the frequencies of %51, %26.8, %13.4 and %8.8, respectively. Five genotypes including AA, AB, BB, AC and AD were identified with the frequency of %14.432, %28.866, %12.371, %26.80 and %17.525, respectively. The results indicated polymorphism and high heterozygosity in the population under study. Also, the number of effective alleles, Shannon index, expected and observed heterozygosity for this site was calculated at 2.794, 1.179, 0.642 and 0.732, respectively. Moreover, the chi-square (χ2) test showed that population was not in Hardy-Weinberg equilibrium. The ANOVA results showed that the effect of different genotypes on birth weight was significant (p<0.05), but it was not significant on 3 MW (p<0.05). Furthermore, other traits such as dam age, sex, season and birth type effects were not significant on the growth traits (p<0.05). The highest birth weight was found for heterozygous AC and AD genotypes (3.05 and 3.02 Kg, respectively), and the lowest birth weight was related to pure AA genotype (1.75 Kg). It seems that selecting AC and AD genotypes can be expected to increase birth weight in Adani goat. Also, we expect that this gene can act as a candidate gene for genetic improvement of some growth traits in goat breeding programs.
Keywords: Polymorphism, MHC Gene, RFLP, Adani Goat -
این پژوهش به منظور بررسی اثر گیاه خارخاسک بر نسبت جنسیت اسپرم قوچ عربی خوزستان با تکنیک qPCR Real-time با استفاده از 18 راس قوچ عربی خوزستان با سه تیمار انجام شد. ژنهای SRY و PLP به ترتیب برای جداسازی قطعات خاصی از توالی های کروموزوم Y- و X- تکثیر شدند. تیمارهای آزمایشی شامل : 1- گروه شاهد 2- جیره حاوی 15 گرم بر کیلوگرم گیاه خارخاسک 3- جیره حاوی30 گرم بر کیلوگرم گیاه خارخاسک در جیره بود. از تمامی قوچ ها در ماه دهم اسپرم گیری و در ماه هشتم و دهم خونگیری انجام شد. نتایج نشان داد، که با افزایش سطح خارخاسک میزان بیان ژن SRY روند افزایشی داشت و حیواناتی که جیره حاوی 30 گرم در کیلوگرم گیاه خارخاسک را دریافت کردند بالاترین میزان افزایش بیان ژن SRY را داشتند و همچنین با افزایش سطح خارخاسک میزان بیان ژن PLP دارای روند کاهشی بود (0/004=p-value). همبستگی بین ژن SRY و غلظت تستوسترون در سن هشت و 10 ماهگی به ترتیب برابر0/65 و 0/59، و برای ژن PLP و غلظت تستوسترون به ترتیب برابر با 0/61- و 0/66- بود (0/006=p-value). براساس یافته های حاصل از این تحقیق مشخص شد که گیاه خارخاسک با افزایش آندروژن ها سبب افزایش نسبت ژن SRY و اسپرم های حاوی کروموزوم Y و به عبارتی افزایش نسبت جنسیت به سمت ژن نرزایی در قوچ های عربی خوزستان می شود.کلید واژگان: تستوسترون, جنسیت, ژن PLP, ژن SRY, گیرنده آندروژنThe present study was conducted to evaluate the effect of Tribulus Tresstrise (TT) herb on sex ratio of semen in Arabic Khouzestan ram using real time-qPCR technique using 18 rams in a completely randomized design with 3 treatments. The SRY and PLP genes were amplified to isolate the specific fragments of Y- and X- chromosome sequences. The treatments included: i) the control group (0% TT), ii) Diet containing 15 g/kg TT, iii) Diet containing 30 g/kg TT. Sperm sampling was taken from all rams at 10 month of age and blood sampling was performed at 8 and 10 month of age. The results showed that expression rate of SRY gene increased with increasing TT level and rams that received 30 g/kg TT diet had the highest SRY gene expression and PLP gene expression decreased with increasing TT level (p-value =0.004). There was positive correlation between Testosterone concentration and SRY gene expression at 8 (0.65) and 10 (0.59) month of age, and the relationship between PLP gene expression and Testosterone concentration was negative and -0.61 and -0.66 at 8 and 10 month of age, respectively (p-value= 0.006). The results indicated that adding Tribulus Tresstrise herb to the ram diet increases the SRY gene expression and also sperm containing Y chromosome. In other words, it increases the sex ratio toward male gens in Arabic Khozestan ram by increasing the androgen hormones.Keywords: Androgen receptor, PLP gene, Sex, SRY gene, Testosterone
-
شناسایی و تعیین خصوصیات ژنتیکی به منظور حفاظت از تنوع ژنتیکی عامل مهمی در جهت محافظت از حیات گونه ها است. این تحقیق با هدف، شناسایی خصوصیات ژنتیکی جمعیت بز عدنی بر اساس تفاوت های ژن سیتوکروم b و تعیین روابط فیلوژنتیکی آن با گونه های اهلی و وحشی بز موجود در پایگاه اطلاعاتی NCBI انجام شد. از 12 راس بز عدنی خونگیری به عمل آمد و استخراج DNA با استفاده از کیت سیناکلون انجام شد. ناحیه موردنظر (892 جفت باز) توسط آغازگرهای اختصاصی به روش PCR تکثیر و توالی یابی شد. تعداد 5 هاپلوتیپ بر اساس 12 جایگاه چند شکل شناسایی شد. جهش ها همه از نوع انتقالی و خاموش بودند. میزان تنوع هاپلوتیپی، تنوع نوکلئوتیدی و میانگین تفاوت ها نوکلئوتیدی به ترتیب مساوی 57/0، 002/0 و273/2 به دست آمد. این نتایج نشان دهنده تنوع بالا در جمعیت بز عدنی است. نتایج فیلوژنتیکی با استفاده از روش اتصال همسایه ((Nj نشان داد که بز عدنی در شاخه کاپرا هیرکوس قرار می گیرد و بز کاپرا ایگاگروس در شاخه نزدیک تری به گروه بزهای کاپرا هیرکوس و بز عدنی نسبت به کاپرا آیبکس قرار دارد. قرار گرفتن بز عدنی و بز اهلی کاپرا هیرکوس در یک شاخه، به دلیل پراکندگی نژادهای مختلف این گونه در سراسر جهان منطقی است.
کلید واژگان: ژن سیتوکروم b, بز عدنی, درخت فیلوژنی, کاپرا هیرکوس, هاپلوتیپIdentification of genetic characteristics is an important factor for preservation of species life. The aim of this study was to identify the genetic characteristics of the Adani goat populations based on the cytochrome b (Cyt b) gene and to detec its phylogenetic relationships with the domestic and wild goat species using NCBI database. Blood samples were taken from 12 Adani goat and subsequently DNA was extracted using Sinaclon kit. The target area (892 base pair) was proliferated by specific primers using polymerase chain reaction (PCR) method and then sequenced. By analyzing the sequences, 5 haplotypes were identified based on 12 polymorphic sites. All mutation sites were transition and nonsense. The haplotype and nucleotide diversity and the average of a different nucleotide based on Cyt b region were estimated 0.57, 0.002 and 2.273, respectively. These results indicated high genetic variation in Adani goat. Using the NJ phylogenetic test results indicated that the Adani goat was located in the C. hircus branch and C. Aegagrus was in closer to them in compare with C. ibex. The placement of Capra hircus's goats and Adani goats in a similar branch is rational because of the dispersion of various races of this species throughout the world.
Keywords: Cytochrome b Gene_Adani Goat_Phylogeny_Haplotype -
اثر دو رقیق کننده مختلف تریس- زرده تخم مرغ و آندرومد بر کیفیت منی و نسبت جنسیت اسپرم گاو هلشتاین در طول فرآیند رقیق سازی و انجماد با استفاده از تکنیک real- time qPCR بررسی شد. این آزمایش با استفاده از چهار گاو نر نژاد هلشتاین در سن چهار سالگی و به مدت چهار هفته در قالب طرح کاملا تصادفی انجام شد .ژنهای PLP و SRY به ترتیب برای جداسازی قطعات خاصی از توالی های کروموزوم X- و Y- تکثیر شدند. استفاده از رقیق کننده آندرومد در مقایسه با تریس- زرده تخم مرغ، کیفیت منی در انجماد و یخ گشایی را بهبود داد. استفاده از رقیق کننده آندرومد موجب افزایش معنی دار بیان ژن (PLP(0/16±1/43، و(p=0/01) و کاهش معنی دار بیان ژن (SRY(0/11±0/64 و (p=0/009) در حالت مایع و فرایند انجماد شد. استفاده از رقیق کننده تریس- زرده تخم مرغ باعث کاهش معنی دار بیان ژن (PLP (0/06±0/3)، (p<0/0001 و افزایش معنی دار بیان ژن (SRY (1/19±0/05)، (p=0/001 در حالت انجماد شد. براساس نتایج، استفاده از منی رقیق کننده آندرومد و منی منجمد شده با تریس- زرده تخم مرغ به ترتیب سبب افزایش ماده زایی و نرزایی در گله گاو شیری می شود.کلید واژگان: آندرومد, زرده تخم مرغ, ژن PLP, ژن SRY, کروموزوم YThe effects of two different extenders were investigated (Tris- egg yolk and Andromed extenders) on semen quality and sex ratio during the dilution and freezing process in Holstien bull by using the real-time qPCR technique. The experiment was conducted using four 4-years old Holstien bulls for a period of four weeks in a completely randomized design. The PLP and SRY genes were amplified to isolate the specific fragments of X- and Y- chromosome sequences, respectively. Using Andromed diluent in comparison with Tris- eggs yolk improved semen quality during freezing and thawing. Using Andromed extender significantly increased the PLP gene expression (1.43±0.16), (P= 0/01) and reduced SRY gene expression (0.64±0.11), (P= 0/009). Using Tris- egg yolk extender led to a significant reduced in expression of PLP gene (0.3±0.06), (P< 0/0001) and s increased SRY gene expression during freezing (1.19±0.05), (P= 0/001). Based on the results, sperm dilution with Andromed extender and frozen semen with Tris-egg yolk increase birth of female and male in dairy cow herd, respectively.Keywords: Andromed, PLP gene, SRY gene, Y- chromosome, Yolk egg
-
هدفپر از محصولات فرعی صنعت طیور می باشد که به میزان زیادی تولید می شود و 90 درصد ساختار آن از پروتئین غیر محلول کراتین تشکیل شده است. هدف از این مطالعه آنالیز و تعیین خصوصیت باکتری های تولید کننده کراتیناز حاصل از بستر جوجه های گوشتی می باشد.مواد و روش هامقدار 10 گرم بستر مرغداری بر روی محیط کشت اسکیم میلک آگار کشت داده شد. به منظور جداسازی کلنی های کراتینولیتیک، کلنی های جداسازی شده، بر روی محیط کشت جامد حاوی آزوکراتین و کراتین به عنوان تنها منبع کراتین کشت داده شدند. کلنی های با قابلیت هیدرولیز پر انتخاب شده و با استفاده از روش های میکروسکوپی، بیوشیمیایی و مولکولی شناسایی شدند.یافته هادر نتایج حاصل از این مطالعه تعداد 10 سویه باکتریایی با فعالیت پروتئولیتیکی بدست آمد که از این تعداد تنها 4 باکتری توانایی تجزیه کراتین را دارا بودند. طبق نتایج مورفولوژیکی و بیوشیمیایی سویه با بیشترین فعالیت کراتینولیتیکی، زیر گروه کوکوس (استافیلوکوکوس) طبقه بندی شد. بر اساس تکثیر ژن 16S rRNA و آنالیز فیلوژنی، این سویه استافیلوکوکوس لنتوس SLKr1 شناسایی شد که با توجه به قطر هاله ایجاد شده بر روی محیط جامد حاوی کراتین، استافیلوکوکوس لنتوس SLKr1 در بین سایر سویه ها، بیشترین فعالیت کراتینولیتیکی را دارا بود. استافیلوکوکوس لنتوس SLKr1 به عنوان یک سویه جدید کراتینولیتیک با قابلیت بالای کازئیناز می باشد که توانایی تولید آمیلاز، لسیتیناز، سلولاز و ژلاتیناز را ندارد.نتیجه گیرینتیجه گیری کلی از این تحقیق نشان می دهد که باکتری استافیلوکوکوس لنتوس SLKr1 یک باکتری تولید کننده کراتیناز با قابلیت کراتینولیتیکی بالا می باشد که قابلیت استفاده در صنعت بیوتکنولوژی را دارد.کلید واژگان: استافیلوکوکوس لنتوس, باکتری, کراتیناز, غربالگریBackground and ObjectivesFeathers, a largely wastes produced in poultry industries represents a rich insoluble protein resource containing over 90% keratins. The aim of this study was to analyze and characterize the diversity of keratinase producing bacteria in broiler chicken litter house.Materials and MethodsA total of 10 gram samples were cultured in skim milk agar. The isolates were cultured on keratine and Azokeratin agar medium using keratin as the sole source of carbon to isolate keratinolytic microbes. The colonies with high feather hydrolyzing ability were subjected to identification by microscopic observation, biochemical characterization and molecular analysis.ResultsThe results showed that among a total of 10 bacterial strains obtained from skim milk agar plates with proteolytic activity, only four bacteria were capable of degrading keratin. According to the biochemical and morphological characters, the isolated strain was grouped under the genus of Coccus (Staphylococcus). Based on 16S rRNA typing and phylogenetic analysis this strain was identified as Staphylococcus lentus SLKr1 and according to diameter clear zone on keratin agar medium, exhibited higher level of keratinolytic activity among other isolated strains.ConclusionStaphylococcus lentus SLKr1 as a new keratinase producing bacteria also possessed high caseinase activity but was negative in amylase, lecithinase, cellulase and gelatinase production. Taken together, these results suggest Staphylococcus lentus SLKr1, a new keratinase producing bacteria with high keratinolytic activities which have the potential use in industrial biotechnology.Keywords: Bacteria, Keratinase, Screening, Staphylococcus lentus
-
تب بیدوام گاوی (BEF) یک بیماری ویروسی در گاو و گاومیش است که در سالهای اخیر در برخی از استانهای ایران به ویژه مناطق جنوبی و گرم دیده شده است. گلیکوپروتئین G، آنتیژن اصلی حفاظتی ویروس تب بیدوام گاوی (BEFV) و هدف آنتیبادی های خنثی کننده ضدویروسی است. هدف از مطالعه ی حاضر، کلونینگ و بیان اپیتوپ G1 از ژن گلیکوپروتئین G ویروس BEF در یک سیستم پروکاریوتی بود. به این منظور، اپیتوپ G1 درون ناقل بیانی پروکاریوتی (+)pET-24a، تحت کنترل پروموتر T7، کلون و سپس سازه ی نوترکیب pET24-G1 به سویه ی Rosetta اشرشیاکلی منتقل شد. بیان پروتئین نوترکیب با استفاده از روشهای SDS-PAGE و ایمونوبلات بررسی شد. در آنالیز SDS-PAGE پروتئینی با وزن مولکولی تقریبی 18 کیلو دالتون رویت شد که با وزن مورد انتظار برای پروتئین نوترکیب متصل به دنباله ی 6 تایی هیستیدین هم خوانی داشت. آنالیز ایمونوبلات نشان داد که پروتئین G1 بیان شده به طور اختصاصی با سرم پلی کلونال موشی حاوی آنتیبادی ضد BEF واکنش داد. بنابراین در این مطالعه پروتئین G1 از ویروس BEF با موفقیت توسط سازه ی نوترکیب pET24-G1 در اشرشیاکلی بیان شد. براساس نتایج این مطالعه می توان ایمنی زایی و کارآیی این محصول را به عنوان کاندید احتمالی جهت تولید یک واکسن زیرواحدی علیه این ویروس در مدل های حیوانی بررسی نمود.کلید واژگان: ویروس تب بیدوام گاوی, پروتئین نوترکیب G1, اشرشیاکلیBovine ephemeral fever (BEF) is a viral disease of cattle and water buffalo seen in some provinces of Iran, generally southern and warm regions in recent years. The G glycoprotein is the main protective antigen of the bovine ephemeral fever virus (BEFV) and the target of anti-BEFV neutralizing antibodies. The aim of the present study was cloning and expression of the G1 epitope of BEF virus G glycoprotein gene in a prokaryotic system. For this purpose, the G1 epitope was cloned in a prokaryotic expression vector, pET-24a(+), under the control of the T7 promoter and subsequently the recombinant pET24-G1 construct was transformed into Rosetta strain of Escherichia coli. Expressed recombinant protein was analyzed using SDS-PAGE and immunoblotting methods. SDS-PAGE analysis showed that a protein with ~18 kDa molecular weight, consistent with the expected molecular weight of recombinant protein fused to 6xHis tag, was expressed. Immunoblotting analysis showed that the expressed G1 protein specifically reacted with a mouse polyclonal serum against BEFV. Thus, in this study the G1 protein of BEFV was successfully expressed by the pET24-G1 recombinant construct in Escherichia coli. Based on the results of this study, immunization and the efficacy of this product can be consider as a possible candidate for the production of subunit vaccine against the virus in animal models.Keywords: Bovine ephemeral fever virus, Recombinant G1 protein, Escherichia coli
-
فن آوری های ژنومی مانند تعیین ژنوتیپ با کارایی بالا بر اساس آرایه های SNP، پتانسیل بالایی برای رمزگشایی معماری ژنتیکی صفات پیچیده دارد و اطلاعات زمینه ای در مورد ساختار ژنوم در حیوانات اهلی، از قبیل میزان عدم تعادل پیوستگی (LD) فراهم می کند. در این پژوهش، از آرایه ژنومیIllumina Ovine SNP50K BeadChip برای تخمین و مقایسه عدم تعادل پیوستگی، اندازه موثر جمعیت (Ne) و هتروزیگوسیتی در سه جمعیت گوسفند ایرانی شامل گوسفند افشاری (41 راس)، مغانی (35 راس) و قزل (35 راس) استفاده شد. میانگین LD (اندازه گیری شده توسط r2) بین SNP های مجاور با میانگین فاصله 58، 56 و 56 کیلو باز برای همه کروموزوم ها به ترتیب 207/0±151/0 برای نژاد افشاری، 190/0±131/0 برای نژاد مغانی و 184/0±121/0 برای نژاد قزل بود. کروموزوم 2 در نژاد افشاری و قزل و 12 در نژاد مغانی بیشترین میانگین r2 را در کروموزوم های اتوزوم هر نژاد داشتند. نژاد قزل بالاترین مقدار تنوع ژنتیکی را بر اساس اندازه موثر جمعیت و هتروزیگوسیتی نشان داد، در حالی که کمترین مقدار تنوع ژنتیکی در نژاد افشاری مشاهده شد. با توجه به مقادیر پایین عدم تعادل پیوستگی در این بررسی، نتایج مشخص کرد برای به دست آمدن صحت 85 درصدی در بررسی های انتخاب ژنومی و مطالعات پویش پیوستگی ژنومی به آرایه های با تراکم نشانگری بالاتر از 50Kb نیاز خواهد بود.کلید واژگان: عدم تعادل پیوستگی, گوسفند, اندازه موثر جمعیت, هتروزیگوسیتی, ساختار ژنومGenomic technologies, such as high-throughput genotyping based on SNP arrays, have great potential to decipher the genetic architecture of complex traits and provide background information concerning genome structure in domestic animals, including the extent of linkage disequilibrium (LD). In this study, Illumina OvineSNP50 BeadChip array was used to estimate and compare LD, effective population size (Ne) and heterozygosity in three Iranian sheep populations consisting Afshari (N=41), Moghani (N=35) and Qezel (N=35) breeds. The average LD (measured by r2) estimated for all pairwise combinations of SNPs with average distance 58, 56 and 56 Kb were 0.151 ± 0.207 for Afshari, 0.131± 0.190 for Moghani and 0.121 ± 0.148 for Qezel breeds, respectively. The highest averages of r2 on autosomes were obtained for chromosome 2 in Afshari and Qezel and chromosome 12 in Moghani breeds. The Qezel breed showed highest genetic diversity based on effective population size and heterozygosity, whereas the lowest value was found in Afshari breed. Due to low LD values estimated in this study, the results showed to achieve the genomic prediction accuracy of 85% in genomic selection and association studies, the density of marker must be higher than 50K SNPChip.Keywords: Linkage disequilibrium, sheep, Effective population size, Heterozygosity, Genome structure
-
دوپامین در طیور ترشح پرولاکتین را در مغز مهار می کند. این پژوهش به منظور بررسی چند شکلی گیرنده ی1D ژن دوپامین با استفاده از روش PCR-RFLP در مرغ بومی خوزستان صورت گرفت. به منظور اجرای این آزمایش نمونه خون از 100 قطعه مرغ بومی مرکز مرغ بومی خوزستان (شرکت نهاده های دامی جاهد) به صورت تصادفی اخذ گردید. DNA ژنومی با استفاده از روش نمکی بهینه شده، استخراج گردید. واکنش زنجیره ای پلیمراز جهت تکثیر قطعه 283 جفت بازی گیرنده ی 1D ژن دوپامین انجام گرفت. جهت تشخیص ژنوتیپ های گیرنده ی 1D ژن دوپامین، محصولات PCR با استفاده از آنزیم برشیBseNI هضم شدند. با مشاهده نتایج الگوی باندی ناشی از هضم مشخص شد که جهش مسئول گیرنده ی 1D ژن دوپامین به وسیله این روش قابل شناسایی نیست اما با تعیین توالی در Clastal W2، دو جهش در بازهای 123 و 198 ) به ترتیب از نوع A به G و C بهT ) مشخص شد.کلید واژگان: چندشکلی, دوپامین, کرچی, مرغ بومی, PCR-RFLPIntroductionThis research was conducted at the Department of Animal Science in the Ramin Agriculture and Natural Resources University in 2014-2015. The elevation of egg production and the inhibition of incubation behavior are the aims of modern poultry production . Prolactin is postulated to play a critical role in the onset and maintenance of incubation behavior in birds .In avian, dopamine inhibits prolactin secretion in the brain. So far, at least five distinct dopamine receptor subtypes, DRD1-DRD5, have been identified and classically divided into two classes referred to as D1-like (DRD1 and DRD5) and D2-like (DRD2,DRD3, and DR 4) .DRD1 is located on chromosome 13 and contains an open reading frame of 1356 nucleotides encoding a protein of 451 amino acids. Dopamine stimulates prolactin secretion via activating DRD1 at the hypothalamus level by operating through vasoactive intestinal peptide and the inhibition effect of dopamine on Prolactin secretion is mediated through DRD2 receptors at the pituitary level.This study aimed at identification of the variants of dopamine D1 receptor gene and detection of the allelic frequency in the Khuzestan native chicken at Ramin Agriculture and Natural Resources of Khuzestan province.Materials And MethodsFor this research 100 laying hens from Khuzestan native chicken Breeding Center (Jahed Livestock Input Corporation) were randomly selected. DNA was extracted from whole blood using salting-out procedure. The PCR-RFLP method was used for allelic differentiation. Dopamine D1 receptor gene was amplified by a specific set of primer for this gene to produce 283 bp fragment. The PCR reactions were carried out in a total volume of 25 μL containing 150 ng of genomic DNA, 1 μL of each primer, .5 μL dNTP, 1 μL MgCl2, 2.5× PCR buffer and 1 U of Taq DNA polymerase. The amplification was performed in a Eppendorf Mastercycler under the following conditions: 95°C for 3 min; 35 cycles of 95°C for 30 s, 58/4°C for 45 s and 72°C for 30 s; and 72°C for 10 min. The amplified fragment was digested with BseN I restriction enzyme. The digestion mixture was composed of 10μL PCR products, 2μL digestion buffer, and 1μL of each enzyme, and then subjected to electrophoresis separation in 2.5% Agarose gel.Results And DiscussionThe results of the enzyme Restrictive BseNI showed only one A allele and AA genotype and polymorphism was not observed. To determine the quality and quantity of DNA, Nanodrop and Agarose gel was used and the results showed that the extracted DNA was suitable to continue the research. The results of this study were not in par with those of the previous research. Such non compliance could be due to the kind of population studied, the sample size and the type of marker based on which polymorphic was examined. Due to the limited number of cutting sites in restriction enzymes, various DNA fragments were not produced. Therefore, RFLP markers may have not been able to identify all mutations in this sequence. Dopamine receptor gene in Khuzestan native chicken was sequenced for the first time in the present study. Hence, alignment sequences of Khuzestan native chicken and alignment sequence in ClastaW2 were saved in the gene bank. The results of sequencing in ClastaW2 recorded two mutations of type A to G in the base 12 and C to T in the base 198.
Considering the results of gene sequencing, it cannot be stated that a dopamine receptor in this research is monomorphic. However, the enzyme used for dopamine gene could not be able to recognize the restriction sites. Sequencing of dopamine D1 receptor gene in the native chicken population of Khuzestan showed mutation which normally causes genetic polymorphism. However, in this study due to the ineffective choice of the enzyme, monomorphism was detected. These results show the importance of restriction enzyme in detecting genetic variation. Since dopamine is one of the main factors known to reduce prolactin and decrease broodiness as well as the reports indicated that mutations in dopamine D1 receptor different genotypes were significantly associated with increased dopamine.ConclusionDue to the important role of restriction enzymes in identification of different mutations, selection of the suitable enzyme is recommended.Keywords: Broodiness, Dopamine, Native chicken, Polymorphism, PCR-RFLP
- در این صفحه نام مورد نظر در اسامی نویسندگان مقالات جستجو میشود. ممکن است نتایج شامل مطالب نویسندگان هم نام و حتی در رشتههای مختلف باشد.
- همه مقالات ترجمه فارسی یا انگلیسی ندارند پس ممکن است مقالاتی باشند که نام نویسنده مورد نظر شما به صورت معادل فارسی یا انگلیسی آن درج شده باشد. در صفحه جستجوی پیشرفته میتوانید همزمان نام فارسی و انگلیسی نویسنده را درج نمایید.
- در صورتی که میخواهید جستجو را با شرایط متفاوت تکرار کنید به صفحه جستجوی پیشرفته مطالب نشریات مراجعه کنید.