سیدغلامعلی جورسرایی
-
ناباروری یک مسئله بهداشتی جهانی است. یکی از عوامل اصلی ناباروری در زنان، سندرم تخمدان پلی کیستیک (PCOS) می باشد. برای درمان اینگونه افراد، روش های متفاوتی به کار گرفته می شود. استفاده از سلول های بنیادی و فرآورده های آن می تواند جایگزین خوبی برای درمان آن باشد. مدل های مختلفی برای القاء PCOS در مدل های حیوانی وجود دارد. سلولهای بنیادی مزانشیمال باعث کاهش اختلال عملکرد تخمدان در موشهای PCOs می شود. تزریق دمی BM-MSC باعث بهبود در روند فولیکولوژنزیس خواهد شد. تزریق سلولهای بنیادی مزانشیمی BM-Hmsc وUC-MSC ، به صورت داخل تخمدانی باعث بهبود روند فولیکوژنزیس می گردد. تزریق سلول بنیادی مزانشیمی AMSCs، با نتیجه مثبتی در باروری همراه است. سلول های بنیادی MSC-EV ، باعث بهبود روند باروری شده و فولیکولوژنز را افزایش می دهند. یکی از دلایل اصلی ناباروری در زنان، تخمدان پلی کیستیک (PCOS) است. استفاده از سلول درمانی برای بیماریهای مختلف از جمله PCOS مطرح است. استفاده از MSC در درمان ناباروری در مراحل تحقیقات پیش بالینی خود قرار دارد. ایمنی و کارایی MSC در درمان ناباروری نیاز به بررسی بیشتر دارد. ما در این مطالعه به بررسی مقایسه ای تاثیرات درمانی سلولهای بنیادی مزانشیمی بر سندرم پلی کیستیک تخمدان در انواع مدل های حیوانی پرداخته ایم.
کلید واژگان: ناباروری، سلول های بنیادی مزانشیمی، مدل حیوانی، سندرم تخمدان پلی کیستیک، درمان با سلولهای بنیادیInfertility is a global health problem. One of the main causes of infertility in women is polycystic ovary syndrome (PCOS). Different methods are used to treat such people. Using stem cells and its products can be a good alternative for its treatment. There are different models for inducing PCOS in animal models. Mesenchymal stem cells reduce ovarian dysfunction in PCOS mice. Tail injection of BM-MSC will improve the process of folliculogenesis. Intraovarian injection of BM-Hmsc and UC-MSC mesenchymal stem cells improves the process of folliculogenesis. AMSCs mesenchymal stem cell injection is associated with a positive result in fertility. MSC-EV stem cells improve fertility and increase folliculogenesis. One of the main causes of infertility in women is polycystic ovary syndrome (PCOS). The use of cell therapy for various diseases including PCOS is considered. The use of MSC in the treatment of infertility is in its preclinical research stages. The safety and efficacy of MSCs in the treatment of infertility needs further investigation. In this study, we have compared the therapeutic effects of mesenchymal stem cells on polycystic ovary syndrome in various animal models.
Keywords: Infertility, Mesenchymal Stem Cells, Animal Model, Polycystic Ovary Syndrome, Stem-Cell Therapy -
مقدمه
ارتباط بین اندومتریوز و اختلالات تیرویید و تاثیر متعاقب آن بر نتایج باروری، هنوز بحث برانگیز است. مطالعه حاضر با هدف ارزیابی تاثیر اختلال در سطوح هورمون محرک تیرویید (TSH) بر میزان لقاح زنان مبتلا به اندومتریوز انجام شد.
روش کاردر این آنالیز ثانویه داده های کوهورت، 179 زن نابارور مبتلا به اندومتریوز به عنوان گروه مورد و 200 زن با تشخیص فاکتور لوله ای یا ناباروری غیرقابل توجیه به عنوان گروه کنترل انتخاب شدند. دو زیرگروه سطوح TSH بالای 5/2 mlU/L (با یا بدون مصرف لووتیروکسین) و سطح TSH کمتر از 5/2 mlU/L با مصرف لووتیروکسین به عنوان بیماران مبتلا به اختلال عملکرد تیرویید و زنان با سطوح TSH کمتر از 5/2 mlU/L بدون مصرف لووتیروکسین به عنوان افراد سالم از نظر تیرویید در نظر گرفته شدند. تعداد فولیکول آنترال و میزان لقاح بین دو گروه مقایسه شد. تجزیه و تحلیل داده ها با استفاده از نرم افزار آماری SPSS (نسخه 24) و آزمون آنووا انجام شد. میزان p کمتر از 05/0 معنی دار در نظر گرفته شد.
یافته هامیانگینTSH در زنان مبتلا به اندومتریوز نسبت به گروه کنترل به طور معنی داری بالاتر بود (43/0-02/0 :CI 95%، 77/0=d Cohen، 02/0=p). وقتی که زنان بر اساس وجود یا عدم وجود اندومتریوز و سطوح سرمی TSH بالاتر از 5/2 mlU/L طبقه بندی شدند، سطح سرمی FSH (76/0=p)، LH(91/0=p) و میزان لقاح (51/0=p) بین دو گروه اختلاف معناداری نداشت.
نتیجه گیریبه نظر می رسد اختلالات تیرویید در زنان مبتلا به اندومتریوز شایع تر است. با این حال، هیچ تاثیر قابل توجهی بر نتایج روش های کمک باروری ثانویه به همراهی با اندومتریوز و سطوح بالاتر TSH وجود نداشت.
کلید واژگان: اندومتریوز، میزان لقاح، هورمون محرک تیروئیدIntroductionThe relationship between endometriosis and thyroid disorders and the subsequent impact on fertility outcomes is still controversial. The present study was performed with aim to evaluate the effect of impaired thyroid-stimulating hormone (TSH) levels on fertilization rate of infertile women with endometriosis.
MethodsIn this secondary analysis of cohort data, 179 infertile women with endometriosis were selected as the case group and 200 women with diagnosis of tubal factor or unexplained infertility were selected as the control group. Two subgroups of TSH levels above 2.5 mlU/L (with or without levothyroxine use) and TSH levels less than 2.5 mlU/L with levothyroxine use as patients with thyroid dysfunction and women with TSH levels less than 2.5 mlU/L without use of Levothyroxine were considered as thyroid-healthy subjects. Antral follicle count and fertilization rate were compared between the two groups. Data analysis was done using SPSS statistical software (version 24) and ANOVA test. P<0.05 was considered significant.
ResultsThe mean of TSH in women with endometriosis was significantly higher than the control group (P=0.02, Cohen d=0.77, 95% CI: 0.02-0.43). When women were classified based on the presence or absence of endometriosis and serum TSH levels above 2.5 mlU/L, serum levels of FSH (P=0.76), LH (P=0.91), and fertilization rate (P=0.51) did not significantly differ between the two groups.
ConclusionIt seems that thyroid disorders are more common in women with endometriosis. However, there was no significant effect on the results of assisted reproductive procedures related to the coexistence of endometriosis and higher TSH levels.
Keywords: Endometriosis, fertilization rate, thyroid stimulating hormone -
ترکیبات دارای خاصیت آنتی اکسیدانی مانند تیموکینون، به میزان قابل توجهی مانع از ایجاد تغییرات حاصل از اثر مواد شیمیایی سمی نظیر تری سیکلازول روی ارگان های احشایی می شوند. لذا این مطالعه به منظور امکان به کارگیری تیموکینون جهت ممانعت از اثرات مخرب سم تری سیکلازول بر روند اسپرماتوژنزیس رت های نر انجام شد. در این مطالعه تجربی، تعداد 42 سر موش صحرایی نر به طور تصادفی به 7 گروه شامل: گروه کنترل (بدون دریافت دارو)، گروه شم (محلول 10 درصد تویین 80)، گروه 20 میلی گرم بر کیلوگرم تری سیکلازول، گروه آزمایشی 10 میلی گرم بر کیلوگرم تیموکینون، گروه آزمایشی 20 میلی گرم بر کیلوگرم تیموکینون، گروه آزمایشی تری سیکلازول 20 و تیموکینون 10 و گروه تری سیکلازول 20 و تیموکینون 20 تقسیم شدند. در پایان دوره ی تیمار، با تهیه برش های بافتی از بیضه، سلول های مسیر اسپرماتوژنز در واحد سطح مورد ارزیابی قرار گرفتند. طبق یافته ها، میانگین تعداد و تحرک اسپرم و تعداد سلول های اسپرماتوگونی در گروه های تیموکینون 20 و گروه تیموکینون 10 در مقایسه با گروه تری سیکلازول افزایش معنی داری را نشان داد (05/0 <p)؛ اما تعداد سلول های لیدیگ در گروه های تیموکینون 20 و گروه تیموکینون 10 در مقایسه با گروه تری سیکلازول کاهش معنی داری را نشان داد (05/0 <p). نتایج مطالعه نشان داد که تیموکینون به عنوان یک آنتی اکسیدان قوی می تواند سمیت ناشی از تری سیکلازول بر فرآیند اسپرماتوزنز را تا حدودی جبران نماید.
کلید واژگان: تیموکینون، اسپرماتوژنزیس، سم تری سیکلازول، آنتی اکسیدانتCompounds with antioxidant properties such as thymoquinone (TQ) significantly prevent changes resulting from the effect of toxic chemicals such as tricyclazole on visceral organs. Therefore, this study was conducted in order to use thymoquinone to prevent the destructive effects of tricyclazole on the process of spermatogenesis in male rats. In this experimental study, 42 male rats were randomly divided into 7 groups including: control group (no drug), sham group (10% solution of Tween 80), tricyclazole (20 mg/kg) group, thymoquinone (10 mg/kg) group, thymoquinone (20 mg/kg) group, tricyclazole (20 mg/kg) + thymoquinone (10 mg/kg) group, and tricyclazole (20 mg/kg) + thymoquinone (20 mg/kg) group. At the end of the treatment period, by preparing tissue sections from the testis, the cells of the spermatogenesis pathway were evaluated per unit area. According to the findings, the average number and motility of sperm and the number of spermatogonial cells in the thymoquinone 20 and thymoquinone 10 groups showed a significant increase compared to the tricyclazole group (p < 0.05); However, the number of Leydig cells in the thymoquinone 20 and thymoquinone 10 groups showed a significant decrease compared to the tricyclazole group (p < 0.05). The results of the study showed that thymoquinone, as a strong antioxidant, can partially compensate for the toxicity caused by tricyclazole on the spermatogenesis process.
Keywords: Thymoquinone, Spermatogenesis, Tricyclazole Toxin, Antioxidant -
هدف
این مطالعه به منظور سنتز داربست فیبرویینی الکتروریسی شده و تاثیر وابسته به زمان پیش-انکوباسیون آن در محیط کشت بر روی چسبندگی سلولی و تکثیر سلول های کاشته شده بر روی داربست انجام گردید.
روش بررسیابتدا سریسین زدایی پیله ابریشم و آماده سازی فیبرویین انجام شد و سپس محلول فیبرویین 3% با استفاده از اسید فرمیک تهیه شد. سپس با دستگاه الکتروریسی آزمایشگاهی، داربست فیبرویینی الکتروریسی شده ساخته شده و با میکروسکوپ الکترونی نگاره مورد ارزیابی قرار گرفت. پیش-انکوباسیون داربست در محیط کشت به مدت صفر، 1، 6، و 10 روز انجام شد و با روش اندازه گیری زاویه تماس قطره آب، میزان آب دوستی داربست ها ارزیابی گردید. سپس سلول های مزانشیمی مغز استخوان رت جداسازی، کشت، و بر روی داربست ها کاشت گردید. بعد از 21 روز از کاشت سلول ها، میزان بقا سلول ها (به روش MTT) و غلظت DNA ژنومی سلول های چسبیده به داربست مورد ارزیابی قرار گرفت.
نتایجنتایج نشان دادند که افزایش مدت زمان پیش -انکوباسیون داربست در محیط کشت منجر به کاهش زاویه تماس و افزایش بقا و تکثیر سلول ها گردید. به طور کلی مطالعه کنونی نشان داد که پیش -انکوباسیون داربست فیبرویینی الکتروریسی شده با الاستیسیته ثابت در محیط کشت منجر به افزایش آب دوستی داربست و متعاقبا افزایش تکثیر و بقا سلول های مزانشیمی کاشته شده بر روی آن می گردد
نتیجه گیریاز این یافته میتوان به عنوان یک فاکتور موثر در آماده سازی کاشت سلول های غضروفی بر روی داربست در مهندسی بافت استفاده کرد.
کلید واژگان: الکتروریسی، داربست، فیبروئین، کشت سلولObjectiveThis study was performed to synthesize electrospun silk fibroin scaffold and to investigate the time-dependent effect of its pre-incubation in culture medium on the adhesion and proliferation of cells seeded on the scaffold.
Methodssericin was removed from silk cocoon and fibrin solution (3% w/v) was prepared using formic acid. Then, electrospun silk fibroin scaffold was made using lab-scale electrospinning machine and evaluated by scanning electron microscopy. Pre-incubation of scaffolds in culture medium was performed for 0, 1, 6, and 10 days and the hydrophilicity of scaffolds was evaluated by measuring the water contact angle. Rat bone marrow mesenchymal cells were then isolated, cultured, and seeded on scaffolds. After 21 days of cell seeding, cell viability (MTT method) and genomic DNA concentration of cells attached to the scaffold were evaluated.
ResultsThe results showed that increasing the pre-incubation time in the culture medium decreased the water contact angle and increased the survival and proliferation of cells. In general, the present study showed that pre-incubation of electrospun fibroin scaffold with constant elasticity in culture medium leads to increased scaffold hydrophilicity and consequently increases the proliferation and survival of mesenchymal cells seeded on it.
Conclusionthese findings can be used as an effective factor in seeding cartilage cell on scaffolds in tissue engineering.
Keywords: Electrospinning, scaffold, Fibroin, Cell Culture -
رتینوییدها و فاکتور سلول بنیادی نقش مهمی در تکثیر، بقا و تمایز سلول های بنیادی به اسپرم ایفا می کنند. لذا در این مطالعه اثر فاکتور سلول بنیادی و رتینوییدها بر تکثیر و تمایز سلول های اسپرماتوگونی در لوله های اسپرم ساز بیضه رت بالغ مدل آزواسپرمی انسدادی با استفاده از سیستم کشت بافت مورد ارزیابی قرار گرفته است. قطعات بافت بیضه در محیط کشت مکمل با رتینوییدها یا فاکتور سلول بنیادی و یا ترکیبی از هر دو در شرایط دمای 5/34 درجه سانتی گراد و دی اکسید کربن 5 درصد به مدت 25، 30 و 35 روز کشت داده شدند. سپس مقاطع بافتی تهیه شده در زمان های مذکور به وسیله رنگ آمیزی پاس و هماتوکسیلین مورد ارزیابی مورفولوژیکی قرار گرفتند. شمارش سلولی در واحد سطح با استفاده از نرم افزارImageJ و تجزیه و تحلیل آماری، با استفاده از آنالیز واریانس یک طرفه، ANOVA و آزمون تعقیبی توکی انجام شد. تعداد سلول های اسپرماتوگونی، اسپرماتوسیت و لایدیگ در روز 25، 30 و 35 کشت و همچنین تعداد سلول اسپرماتید گرد و دراز در روز 35 کشت در بافت بیضه آزواسپرمی انسدادی در مقایسه با گروه های تجربی و کنترل افزایش معنی دار داشتند (001/0>p). بررسی هیستولوژیک بافت بیضه در شرایط مختلف کشت، تغییرات پاتولوژیک را در سلول های سازنده اپی تلیوم نشان داد. رتینوییدها در روز 35 کشت در مقایسه با فاکتورهای دیگر در حفظ و تکثیر رده های سلولی فرایند اسپرماتوژنز نقش موثرتری داشتند. از آنجاییکه این فاکتورها به تنهایی عامل القا تکثیر و تمایز نیستند، بنابراین بهینه سازی محیط کشت جهت دستیابی به اسپرم بالغ پیشنهاد می شود.کلید واژگان: رتینوئیدها، فاکتور سلول بنیادی، کشت بافت، آزواسپرمی انسدادی، رتRetinoids and stem cell factor play an important role in the stem cells proliferation, survival, and differentiation into sperm. Therefore, in this study, the effect of stem cell factor and retinoids on the proliferation and differentiation of spermatogonial cells in testis seminiferous tubules of obstructive azoospermia model adult rats was investigated using the tissue culture system. The testicular tissue fragments were cultured in the culture medium supplement with retinoids or stem cell factor, or a combination of both at the temperature of 34.5 °C and 5% CO2 for 25, 30, and 35 days. Then, the stained tissue sections prepared at the mentioned times were evaluated using PAS and hematoxylin staining methods. The cell counting per unit area was done using ImageJ software, and the statistical analysis was performed by one-way ANOVA and Tukey's post hoc test. The number of spermatogonia, spermatocyte, and Leydig cells increased significantly on day 25, 30 and 35 of culture; additionally, the number of round and elongated spermatid increased significantly on day 35 of culture in the testicular tissue of the obstructive azoospermia compared to the experimental and control groups (p < 0.001). Histological examination of testicular tissue in different culture conditions revealed pathological changes in the epithelialmaking cells. Retinoids played a more effective role on day 35 of culture compared to other factors in maintaining and proliferation of cell lines of the spermatogenesis process. As these factors are not alone the cause of proliferation and differentiation induction, therefore optimizing the culture medium is recommended to achieve adult sperm.Keywords: Retinoids, Stem Cell Factor, tissue culture, Obstructive Azoospermia, Rat
-
زمینه و هدف
تزریق اسپرم به داخل تخمک (ICSI) در زوجین نابارور، تحولی شگرف در درمان این بیماران ایجاد نموده است. متاسفانه علی رغم هزینه بالای انجام ICSI، میزان موفقیت آن چشم گیر نبوده و شکست در ایجاد حاملگی، استرس سنگینی به آن ها تحمیل می کند. هدف از این تحقیق کوششی برای استخراج بهترین پارامتر های پیشگویی کننده در میزان موفقیت ICSI و ارتقای دقت، حساسیت و ویژگی پیشگویی به کمک مدل ریاضی لوژستیک رگرسیون و شبکه عصبی مصنوعی می باشد.
روش کاراطلاعات لازم از پرونده 345 بیمار تحت درمان ICSI و در قالب 54 پارامتراسمی و عددی استخراج گردید. داده ها به صورت تصادفی به دو دسته تخمین و یا آموزش (276n=) و اعتبارسنجی یا آزمون (69 n=) تقسیم شدند. مدل های بکاربرده شده در این تحقیق باینری لوژستیک رگرسیون و شبکه عصبی با الگوی یادگیری لونبرگ مارکوارد بودند. نهایتا مدل ها بوسیله شاخص هایی مانند دقت، حساسیت و ویژگی ارزیابی گردیدند.
یافته هابهترین خروجی بدست آمده با مدل باینری لوژستیک و با استفاده از 54 متغیر 97% دقت، 86% حساسیت و 94% ویژگی را بدست داد. بهترین خروجی برای شبکه عصبی با استفاده از الگوی آموزشی لونبرگ مارکوارد با مدل کاهش یافته شامل تعداد 29 متغیر، دقت 82%، حساسیت 92% و ویژگی 76% بدست داد.
نتیجه گیریمدل باینری لوژستیک رگرسیون دارای قدرت زیادی در پیشگویی میزان موفقیت تزریق داخل سیتوپلاسمی تخمک هنگامی که خروجی به صورت باینری است می باشد.
کلید واژگان: تزریق داخل سیتوپلاسمی تخمک، لوژستیک رگرسیون، شبکه عصبی مصنوعیBackgroundIntra-cytoplasmic sperm injection (ICSI) in infertile couples has created a great improvement for treatment of these patients. Unfortunately, despite of high cost of doing ICSI the rate of success is not acceptable and failing pregnancy put a heavy anxiety to couples. This study is aimed to make an effort in order to extract the best predictors for predict the success rate of intra cytoplasmic sperm injection and promote accuracy, sensivity and specificity by the use of artificial neural network and logistic regression.
Methods345 patients received ICSI treatment and each of which constructed of 54 numerical and nominal records. This database was randomly divided into the estimation (n=276) and validation (n=69) data set. The models were used based on binary logistic regression (BLR) feature selection tools and Levenberg-Marquardth neural network classifier. Finally, models were evaluated using important criteria such as accuracy, sensitivity and specificity.
ResultsThe best output of the B LR model by using 54 variables revealed accuracy (97%), sensitivity (86%)and specificity (%94). The best output of the LMNN model using Reduced dataset consisted of n=29 with a feature vector side yielded the accuracy (82%) and sensitivity (%92) and specificity (%76).
ConclusionOur result demonstrated that BLR model outperformed highlighting the great power of BLR in success rate of ICSI prediction while using binary output.
Keywords: Intra cytoplasmic sperm injection, Logistic regression, Artificial neural network -
سابقه و هدف
علی رغم پیشرفتهای فراوان در زمینه روش های کمک باروری، اما هنوز میزان لانه گزینی پس از انتقال جنین افزایش چشمگیری نداشته است. لذا این مطالعه به منظور بررسی برخی عوامل احتمالی موثر بر شکست مکرر لانه گزینی جنین (Recurrent Implantation Failure) در درمانهای کمک ناباروری انجام شد.
مواد و روش هااین مطالعه گذشته نگر بر روی 80 بیمار نابارور با حداقل سابقه 3 بار شکست در لانه گزینی جنین(RIF) پس از درمانهای کمک ناباروری، مراجعه کننده به مرکز ناباروری فاطمه الزهرا (س) بابل طی سالهای 96-1392 انجام شد. 80 نفر از خانمهایی که با انجام یک نوبت انتقال جنین در IVF باردار شدند نیز بعنوان گروه شاهد در نظر گرفته شدند. متغیرهای مربوط به ناباروری، اختلالات اندوکرین و آندومتریوز ثبت و اثر آن بر شکست مکرر لانه گزینی جنین در دو گروه مقایسه شد.
یافته هامیانگین BMI بیماران گروه مورد 63/3±39/26 و گروه شاهد 4/49±26/77 بوده است. شاخص توده بدنی (BMI) بالاتر از 30 بطور معنی داری موجب افزایش خطر شکست مکرر لانه گزینی جنین شده است (0/001=p). بعد از تعدیل اثر سایر عوامل مداخله کننده احتمالی، احتمال خطر(Odds ratios) چاقی بر عدم لانه گزینی مکرر با CI-95%، (1/19-0/91) 1/09 محاسبه شد، که معنی دار نبوده است (0/06p=). بین متغیرهای علت و نوع ناباروری، اختلالات اندوکرین، ناهنجاری های رحمی، آندومتریوز، تخمدان پلی کیستیک و عامل شکست مکرر لانه گزینی جنین در دو گروه مورد و شاهد تفاوت معنی داری وجود نداشت.
نتیجه گیرینتایج این مطالعه نشان داد که BMI، نوع و علت ناباروری، اختلالات اندوکرین، ناهنجاری های رحمی، آندومتریوز، تخمدان پلی کیستیک بر شکست مکرر لانه گزینی جنین موثر نبوده اند.
کلید واژگان: لانه گزینی جنین، چاقی، شاخص توده بدنی، ناباروریBackgroundDespite many advances have been made in the assisted reproduction techniques (ART), implantation rate after embryo transfer has not increased significantly. This study aims to determine the factors involved in recurrent implantation failure (RIF) following ART.
MethodsIn this retrospective study, 80 infertile patients with a history of at least 3 recurrent implantation failure (RIF) following assisted reproductive technology (ART) were referred to Fatemezahra Infertility Center in Babol from March 2006 to March 2013 were selected. The control group also included 80 women who became pregnant following the first IVF. Associated factors of infertility, endocrine disorder and endometriosis were recorded and their effect on RIF was assessed in both groups. P-value<0.05 was considered significant.
ResultsThe mean BMI was 26.39±3.63 in the case group and 26.77±4.49 in the control group. Body mass index (BMI) >30 increased the risk of RIF significantly (P = 0.001). After adjusting for the effects of other possible confounding factors, the odds ratio of obesity on RIF was 1.09 (0.91-1.19) 95% CI which was not significant (P = 0.06). There were no significant differences among type and cause of infertility, endocrine abnormalities, uterine malformations, endometriosis and polycystic ovary with RIF.
ConclusionAccording to our findings, BMI, type and cause of infertility, endocrine disorders, uterine abnormalities, endometriosis, and polycystic ovary were not effective on recurrent implantation failure. Future studies by eliminating the effect of more confounders may clarify our findings.
Keywords: Embryo implantation, Obesity, Body mass index, Infertility -
International Journal of Reproductive BioMedicine، سال شانزدهم شماره 8 (پیاپی 103، Aug 2018)، صص 507 -518مقدمه
پروتئین شکل دهنده استخوانی 4 (BMP4) یک مولکول قابل توجه است که سبب شروع تمایز و اثرات چند جانبه بر روی سلول های بنیادی جنینی و جنین می شود.
هدفدر این مطالعه با استفاده از مدل تمایز آزمایشگاهی القا تمایز از سلول های بنیادی جنینی به سلول های زایا با استفاده از BMP4 انجام شد. موارد و
روش هاما از رده سلول های بنیادی جنینی موشی Oct4-GFP برای تشکیل تجمعات جسم جنین دو روزه استفاده کردیم. سپس سلول های تک سلولی شده جسم جنینی به مدت چهار روز کشت شدند. پس از انجام تست MTT و ارزیابی بیان ژن های Vasa و Riken با استفاده از RT-PCR real time در 6 غلظت مختلف، دز ng/mL 12/5 به عنوان دز بهینه BMP4 تعیین شد. میزان بیان ژن هایFkbp6, Mov10l1,Riken ,Tex13, Mvh, Scp3, Stra8, Oct4 ارزیابی شد. فلوسایتومتری و رنگ آمیزی ایمونوهیستوشیمی جهت تایید یافته های ریل تایم انجام شد.
نتایجدر این مطالعه BMP4 توانست میزان بیان بعضی از ژن های سلول های زایا را نسبت به گروه کنترل افزایش دهد. در گروه +BMP4 میزان بیان ژن (0/001≥p) Riken و (0/001≥p) Vasa با تفاوت معنی داری نسبت به گروه کنترل افزایش یافت. همچنین Tex13، (0/22p=)Mov1011 (0/61p=)Scp3، (0/90=p)Fkbp6 ، (0/10p=) و (0/08p=) Stra8 نسبت به گروه کنترل افزایش یافتند ولی این تفاوت معنی دار نبود. نتایج آزمون فلوسایتومتری نشان داد میانگین سلول های Mvh مثبت در گروه +BMP4 در مقایسه با گروه های ESCs، –BMP4 و EB بیشتر بود به ترتیب (0/001p=، 0/02 p=، 0/03p=).
نتیجه گیریکاهش میزان بیان ژن Oct4 به عنوان یک فاکتور پرتوانی در راستای بیان مارکرهای میوزی این فرضیه ایجاد می شود که BMP4 سبب تمایز سلول های بنیادی جنینی به سلول های شبه سلول های زایا درمرحله تقسیم اول میوزی شد.
کلید واژگان: پروتئین تغییر شکل دهنده استخوانی 4، سلول های بنیادی جنینی، سلول زایا، جسم جنینیBackgroundBone morphogenetic protein 4 (BMP4) is a significant signaling molecule that involves in initiating of differentiation and performs multifunctional effects on embryonic stem cells (ESCs) and embryos.
ObjectiveThe goal of the present study was to evaluate an in vitro differentiation model of mouse embryonic stem cells into germ cells, using BMP4.
Materials And Methodsin this experimental study, we used Oct4-GFP mouse ESCs to form embryoid body (EB) aggregations for two days. Then, single cells from EB were cultured for four days with BMP4. Using MTT assay and gene expression levels for evaluation of Mvh and Riken by real-time RT-PCR of six concentrations, 12.5 ng/ ml BMP4 was determined as an optimized dose. Then, the expression level of Fkbp6, Mov10l1, 4930432K21Rik, Tex13, Mvh, Scp3, Stra8, Oct4 were evaluated. Flow cytometry and immunostaning were used to confirm the findings of the real-time RT-PCR.
ResultsIn the Ӄ group, the genes encoding Riken (p≤0.001) and Mvh (p≤0.001) were found to be increased with significant differences compared with the control group. Mov10l1 (p=0.22), Tex13 (p=0.10), Fkbp6 (p=0.90), Scp3 (p=0.61) and Stra8 (p=0.08) were up-regulated without significance differences compared with control group. Flow cytometry analysis showed that the mean number of Mvh-positive cells in the Ӄ group was greater when compared with ESCs, -BMP4 and EB groups (p=0.03, p≤0.001, p=0.02, respectively).
ConclusionDown-regulation of Oct4, expression of germ cells genes and meiosis markers expression raise this hypothesis that ESCs were differentiated by BMP4, and may be introduced into the first meiosis as germ cell-like cells.
Keywords: Bone morphogenetic protein, Embryonic stem cells, Germ cells, Embryoid body -
سابقه و هدفسموم مختلف روی اندام های تناسلی اثر سوء دارند. مواجهه با آلاینده ها و همچنین استرس های جسمی، باعث افزایش نرخ ناباروری می شود. تولیدات آنتی اکسیدانی به دلیل اینکه می توانند در برابر آلاینده ها و حذف رادیکال های آزاد اکسیژن واکنش نشان دهند، بسیار مورد توجه قرار گرفته اند. این مطالعه به بررسی تاثیر پروتکتیو ها در محافظت از سیستم تولید مثلی در برابر سموم می پردازد.مواد و روش هااین مطالعه مروری با استفاده از کلمات کلیدی پروتکتیو و سموم ارگانوفسفره، و جستجو در وب سایت های Pubmed، Science Direct، Scopus و Google Scholar انجام گردید و مقالات مرتبط استخراج و طبقه بندی شدند.یافته هانتایج مربوط به حدود هشتاد مقاله انتخاب شده از میان یکصد و چهل مقاله جدید و معتبر، حاکی از آن است که عناصری مثل ارسنیک، سیکلوفسفامید، کادمیوم، دیازینون و گوسیپول باعث کاهش میزان تولید مثلی و آسیب به بافت های بدن می شوند. عناصری مثل ان استیل سیستئین، کارنیتین، کورسیتین، روغن سیاه دانه، پودر خرما، جنسینگ، عسل و زعفران از عناصر پروتکتیوی هستند که می توانند در مقابل آسیب های احتمالی اثر محافظتی داشته باشند.نتیجه گیریبر اساس نتایج این مطالعه می توان از پروتکتیو های طبیعی موجود در گیاهان، میوه ها و مواد خوراکی جهت جلوگیری از آسیب سموم مختلف به دستگاه تولید مثلی استفاده کرد.کلید واژگان: پروتکتیو، تراتوژن، اسپرم، جنینBackground And ObjectiveDifferent toxins have harmful effects on sexual organs. Exposure to contaminants as well as physical stress can increase the rate of infertility. Antioxidant products are highly considered, because they can react to pollutants and remove free oxygen radicals. This study investigates the effects of proteins on the protection of the reproductive system against toxins.MethodsThis review article was conducted using keywords including protective and organophosphorus toxins, and searching on online databases such as Pubmed, Science Direct, Scopus and Google Scholar. The related articles were extracted and classified.
FINDINGS: The results of about 80 articles, selected out of 140 new and valid articles, suggest that elements such as arsenic, cyclophosphamide, cadmium, diazinon and gossypol reduce the reproduction rate and damage body tissues. Elements such as N-acetylcysteine, carnitine, corsetine, black seed oil, palm powder, ginseng, honey and saffron are proteins that may have protective effects against potential damage.ConclusionBased on the results of this study, the natural proteins that can be found in plants, fruits and food can be used to prevent the damage to the reproductive system caused by various toxins.Keywords: Protective, Teratogen, Sperm, Embryo -
سابقه و هدفانجماد اسپرم در حال حاضر نقش مهمی را در حفظ باروری زوجین تحت درمان ناباروری، به ویژه در بیماران اولیگواسپرمیا و کریپتواسپرمیا، ایفا می کند. برای اجتناب از بیوپسی های مکرر این بیماران زمان زیادی را باید به جمع آوری اسپرم اختصاص داد تا بعد از فراهم شدن شرایط لازم، بیمار در سیکل درمان ناباروری قرار گیرد. این مطالعه به بررسی انجماد اسپرم در نمونه های اولیگواسپرمیا و کریپتواسپرمیا می پردازد.مواد و روش هادر این مطالعه از بانک اطلاعاتی و معتبر NCBI مقالاتی که در زمینه روش های مختلف انجماد اسپرم بودند با استفاده از کلید واژه هایی نظیر الیگواسپرمیا و کریپتو اسپرمیا و انجماد اسپرم و مقالاتی که مقوله انجماد را از دیدگاه پزشکی و کاربردی، مورد بحث و بررسی قرار دادند، استفاده شد.یافته هابرای انجماد اسپرم از سه روش آهسته، سریع و شیشه ای استفاده می شود. نگهدارنده های زیادی همراه با محیط کشت ها برای انجماد اسپرم به کار می روند که برای بقا اسپرم ضروری هستند. از آنجائیکه انجماد ممکن است سبب ضعیف تر شدن حرکت اسپرم در بیمارانی با اختلال شدید اسپرماتوژنزیس گردد محققین درصدد ابداع روش هایی جهت کاهش این اثرات برآمدند. استفاده از زونا پلوسیدا، جلبک ولوکس گلوباتور، آلژینات آگارز، کرایولوپ، نی و سوزن میکرو اینجکشن، روش هایی هستند که برای حفظ و نگهداری و بقا بیشتر اسپرم ها توصیه شده اند.نتیجه گیریبر اساس نتایج این استفاده از ابزارهای مختلف برای نتیجه گیری بهتر در این روش ها به نوع نمونه های دریافتی در این بیماران بستگی دارد.کلید واژگان: الیگواسپرمی، کریپتواسپرمی، نابارورBackground And ObjectiveCryopreservation of sperm currently plays a significant role in maintaining the fertility of couples who undergo infertility treatment, particularly in patients with oligospermia and cryptospermia. To avoid recurrent biopsies, we need to dedicate a lot of time to sperm collection so that the patient is placed in infertility treatment cycles when the necessary conditions are provided. This study is dedicated to Cryopreservation of sperm in oligospermia and cryptospermia samples.MethodsFor this study, we referred to NCBI database and selected articles related to various methods of cryopreserving sperm using certain keywords such as "oligospermia", "cryptospermia" and "cryopreservation of sperm" and articles that surveyed cryopreservation in terms of medical and functional views.
FINDINGS: To cryopreserve sperm, three methods are used; slow, fast and glass. Using several preservatives in culture medium is necessary for survival of sperm. Since cryopreservation may weaken sperm mobility in patients with severe spermatogenesis disorder, researchers seek to devise new methods to reduce these effects. Using zona pellucid, volvox globator algae, alginate-agarose, cryoloop, straw and microinjection needle are among the methods advised for preserving sperms and increasing their survival rate.ConclusionAccording to the results of this study, using different tools to achieve best results depends on the type of samples obtained from these patients.Keywords: Oligospermia, Cryptospermia, Infertile -
سابقه و هدفدر جهان امروز، فقه اسلامی مواجه با مسائل جدیدی است. یکی از این عرصه ها که فقه در باید ها و نبایدهای آن، ورود پیدا می کند، مسئله مرگ مغزی است. آیا مرگ مغزی از دیدگاه فقه و شرع اسلام، پایان زندگی تلقی می گردد. در این مطالعه مرگ مغزی را از دیدگاه فقه شیعه و با در نظر گرفتن نظر متخصصین ذیربط مورد بررسی قرار گرفت.مواد و روش هااین مطالعه بر اساس روش گردآوری کتابخانه ای و همچنین بررسی متونی که در زمینه مرگ مغزی انتشار یافته بودند، طراحی گردید. از آیات قرآن، فتاوی عالمان دینی و احادیث استفاده گردید. بعضی از مقالاتی که مبتنی بر فقه اسلام، به ویژه فقه شیعه مرگ مغزی را تبیین کرده بودند، مد نظر قرار گرفتند.یافته هامرگ مغزی از جهت شرعی و فقهی، پایان زندگی تلقی می گردد. جدا کردن اعضای اصلی او قتل نفس نخواهد بود. شخص مبتلا به مرگ مغزی، یک انسان مصدوم زنده عرفی نیست. انسان مبتلا به مرگ مغزی حیات نداشته و از بین بردن آن، مصداق موضوع قتل قرار نمی گیرد. قطع عضو بیمار مرگ مغزی برای اهداء و پیوند به دیگران، همانند قطع عضو یک فرد مرده هست. اگر حیات مسلمانی منوط به پیوند گرفتن از اجزاء بدن بیمار مرگ مغزی باشد، جایز خواهد بود.نتیجه گیریاگر حیات مسلمانی نیاز به پیوند اعضاء بیماران مبتلا به مرگ مغزی باشد، علی القاعده از نظر شرعی جایز است.کلید واژگان: مرگ مغزی، مرگ شرعی، احکام فقهی، قطع عضو، پیوند عضوBackground And ObjectiveIn today's world, Islamic jurisprudence encounters new issues. One of the areas where jurisprudence gets involved is the issues concerned with brain death, whether brain death in jurisprudence and Islamic law is considered the end of life. In this study, brain death was discussed from the Shiite jurisprudence perspective and also the opinions of the specialists are taken into account.MethodsThis study is designed based on library collection and review of the literature in the field of brain death. Also, Quranic verses, hadiths and fatwas (religious opinions) of the scholars are used. Some of the articles which were centered around Islamic jurisprudence, particularly Shiite jurisprudence that explain and deal with brain death were given special consideration.
FINDINGS: Brain death from religious and jurisprudence perspective is considered the termination of life and removing the vital organs from the body is not viewed as committing manslaughter. A person with brain death is not a normally known injured man who is still alive. The brain death patinets have no life and getting rid of the body does not constitute a case of manslaughter. Amputation of the organs of brain death patients for donation and transplantation amounts to the amputation of a dead body. If the life of a Muslim is subject to transplant of organs from the body of a brain death patient, it will be permissible.ConclusionIn principle, if the life of a Muslim entails transplant of organs of brain death patients, it will be permissibleKeywords: Brain death, Religious death, Jurisprudence verdicts, Amputation, Organ transplants -
ژن NR5A1، که تنظیم کننده رونویسی از ژن های درگیر در محور استروئیدوژنیک هیپوتالاموس-هیپوفیز است، عضوی از خانواده رسپتورهای هسته ای می باشد. برخی از موتاسیون های موجود در این ژن از قبیل c.712G>A، c.634G>A، c.571C>T و c.392C>T می تواند با اختلالات اسپرم زایی ارتباط داشته باشد. هدف از این مطالعه بررسی ارتباط ترانسورژن G>C368 و ترانزیشن C>T 386 ژن NR5A1 با ناباروری در مردان است. در این مطالعه مورد-شاهدی، از 70 مرد نابارور و 75 مرد بارور، به عنوان گروه کنترل، نمونه خون تهیه شد. پس از استخراج DNA ژنومی افراد بیمار و کنترل، ژنوتیپ G>C368 و C>T386 موجود در ژن NR5A1 با کمک RFLP-PCR تعیین شد. در مورد جابجایی G>C368، آنالیز آماری نشان داد که هیچ یک از ژنوتیپ های GC (43/0P=، 26/6-46/0= CI 95% و 69/1OR= ) و یا CC (46/0P=، 41/84-13/0= CI 95% و 38/3OR=) با ناباروری ایدیوپاتیک مردان ارتباط ندارد. آلل C هم فاقد ارتباط با ناباوری (20/0=P،52/7-65/0 CI=95% و 21/2 OR=) بود. اما در مورد جایگاه C>T386، فقط یک نمونه در گروه شاهد دارای ژنوتیپ CT بوده و بقیه نمونه ها ژنوتیپ CC داشتند. بنابراین ژنوتیپ CT فاقد ارتباط با ناباروری مردان (52/0 =P، 79/8-01/1 =CI95% و 35/0 OR=) بود. یافته های این مطالعه نشان داد جابجایی های فوق، نمی تواند مارکر مناسبی جهت استعداد ژنتیکی ابتلا به ناباروری ناشناخته باشد و بنابراین نیاز به بررسی رابطه سایر جهش های تک نوکلئوتیدی این ژن با ناباروری مردان است.کلید واژگان: ژن NR5A1، موتاسیونناباروری مردان، PCR، RFLPJournal of Genetics, Volume:11 Issue: 1, 2016, PP 619 -621The NR5A1 gene, a member of the nuclear receptor family, is a key transcriptional regulator of genes involved in the hypothalamic-pituitary-steroidogenic axis. Some mutations in this gene such as c.392C>T, c.571C>T, c.634G>A and c.712G>A may be associated with abnormal spermatogenesis. The aim of this study was to investigate the association of 368G>C transversion and 386C>T transition in NR5A1 gene with male infertility. In a case-control study, blood samples were collected from 70 infertile men and 75 fertile men as control group. After DNA extraction from case and control samples, the genotypes of 367G>C and 386C>T in NR5A1 gene were detected by PCR-RFLP. Regard to 368G>C transversion, our statistical analysis revealed that GC genotype (OR: 1.69, 95%CI: 0.46-6.26, P= 0.43) and CC genotype (OR: 3.38, 95%CI: 0.13-84.41, P= 0.46) is not associated with idiopathic male infertility. Also C allele (OR: 2.21, 95%CI: 0.65-7.52, P= 0.20) is not associated with male infertility. Regarding to 386C>T, only one sample in control group was detected as CT genotype whereas other samples were CC genotype. Therefore CT genotype (OR: 0.35, 95%CI: 0.01-8.79, P= 0.52) is not associated with male infertility. Our finding showed that aforementioned substitutions are not appropriate biomarkers for idiopathic male infertility. Therefore it is important to study the association of other single nucleotide mutations with male infertility.
-
سابقه و هدفبا توجه به نقش نانوذرات نقره در القاء تولید رادیکال های آزاد، احتمال می رود که نانوذرات نقره سبب اثرات پاتولوژیک و استرس اکسیداتیو در مایع سمینال و در پی آن کاهش کیفیت پارامترهای اسپرم گردند لذا در این مطالعه اثرات سمی نانو ذرات نقره بر پارامترهای اسپرم و میزان پراکسیداسیون لیپیدهای غشایی اسپرم در مایع سمینال موش نر مورد بررسی قرار گرفت.مواد و روش هادر این مطالعه تجربی، 24 موش نر بالغ از نژاد سوری به صورت تصادفی به سه گروه تجربی و یک گروه کنترل تقسیم شدند. نانو ذرات نقره باغلظت 0/07 (گروه A)، غلظت 0/14 (گروه B) وغلظت 0/28 (گروه C) میکروگرم در هر روز، به ترتیب به گروه های اول تا سوم به صورت دهانی به مدت پنج هفته داده شد. سپس میزان پراکسیداسیون لیپیدی غشاء اسپرم به روش تیوباربیتوریک اسید و پارامترهای اسپرمی به روش میکروسکوپی مورد آنالیز قرار گرفت.یافته هاکاهش معنی داری در میانگین کیفیت پارامترهای اسپرمی نظیر تعداد و تحرک اسپرم ها در گروه های تیمار شده با نانوذره، به خصوص گروه های B (به ترتیب ml/106 × 16±2/6 و 16/96±77/69%) و C (به ترتیب ml/106× 13/31±2/1 و 14/52±72/79%) در مقای سه با گروه کنترل (به ترتیب ml/106× 23/57±3/46 و 10/97±89/06%) مشاهده گردید (0/0/5 p<). تفاوت معنی داری در میانگین غلظت مالون دی آلدئید بین گروه های تیمار شده A (0/25±01/0)، B (02/0±32/0)، C (0/35±01/0 و گروه کنترل (0/01±24/0) مشاهده گردید (0/001 p<).نتیجه گیرینتایج مطالعه نشان داد که نانوذرات نقره با افزایش پراکسیداسیون لیپیدی سبب کاهش پارامترهای اسپرم می گردد که اثرات آن وابسته دوز نیز می باشدکلید واژگان: نانوذرات نقره، پارامترهای اسپرم، پراکسیداسیون لیپیدی، موش های نرBackground And ObjectiveConsidering the role of silver nanoparticles in inducing the production of free radicals, these compounds may lead to pathological effects and oxidative stress in the seminal fluid, resulting in the reduced quality of sperm parameters. Therefore, in this study, we aimed to assess the toxic effects of silver nanoparticles on sperm parameters and lipid peroxidation of sperm membranes in male rats.MethodsThis experimental study was conducted on 24 Syrian adult male rats, which were randomly divided into one control and three study groups. The rats in the study groups were orally administered silver nanoparticles at concentrations of 0.07 µg (group A), 0.14 µg (group B), and 0.28 µg (group C), respectively per day for a period of five weeks. Then, lipid peroxidation of sperm membranes was analyzed, using thiobarbituric acid assay. Additionally, microscopic examinations were performed to evaluate sperm parameters.FindingsBased on the findings, the mean quality of sperm parameters such as sperm count and motility significantly declined in the study groups, particularly group B (77.69±16.96%; 16±2.6×106/ml) and group C (72.79±14.52%; 13.31±2.1×106/ml), compared to the control group (89.06±10.97; 23.57±3.46×106/ml) (P<0.05). Also, in terms of malondialdehyde concentration, a significant difference was reported among group A (0.25±0.01), group B (0.32±0.02), group C (0.35±0.01), and the control group (0.24±0.01) (p<0.001).ConclusionThe results of the present study confirmed that silver nanoparticles through enhancing lipid peroxidation could reduce the quality of sperm parameters in a dose-dependent mannerKeywords: Silver Nanoparticles, Sperm Parameters, Lipid Peroxidation, Male Rats
-
International Journal of Reproductive BioMedicine، سال چهاردهم شماره 1 (پیاپی 72، Jan 2016)، صص 39 -46مقدمه
استفاده از فن آوری کمک باروری در جهان درحال افزایش است. میزان، اثربخشی و ایمنی فن آوری کمک باروری در میان کشورها بسیار متفاوت می باشد. کاربرد تزریق داخل سیتوپلاسمی اسپرم، انتقال جنین منفرد و منجمد روبه افزایش است.
هدفهدف از این مطالعه مقایسه میزان حاملگی در انتقال جنین به روش تازه و منجمد بود.
مواد وروش هادراین مطالعه مقطعی گذشته نگر موفقیت باروری 1014 سیکل انتفال جنین از 753 زن مراجعه کننده به مرکز باروری و ناباروی فاطمه الزهرا بابل که تحت درمان تزریق داخل سیتوپلاسمی اسپرم بودند از سال 1387 تا 1392 مورد بررسی قرار گرفت.
نتایجهیچ اختلاف معنی داری بین میزان حاملگی شیمیایی (23% در مقابل 8/18% ، نسبت شانس 301/1، با درجه اطمینان 95% و فاصله اطمینان 77/1-95/0)، ساک حاملگی (6/95% در مقابل 100%، نسبت شانس 60/0، با درجه اطمینان 95% و فاصله اطمینان 67/0-54/0) و فعالیت قلب جنین 2/87% در مقابل6/93% ، نسبت شانس 46/0، با درجه اطمینان 95% و فاصله اطمینان 32/1-16/0) بترتیب بین سیکل های جنین تازه و منجمد وجود نداشت. 05/0<p از نظر آماری برای همه اندازه گیری ها معنی دار در نظر گرفته شد.
نتیجه گیریاگرچه نتایج تحقیق هیچ اختلاف معنی داری بین سیکل های جنین تازه و منجمد نشان نداد، بهرحال جنین های فریز را می توان برای فن آوری کمک باروری بعدی ذخیره کرد. بنابراین ما سیکل های انتقال جنین به روش فریز را به عنوان یک گزینه در کنار انتقال جنین تازه توصیه می کنیم.
کلید واژگان: میزان بارداری، تزریق داخل سیتوپلاسمی اسپرم، انجماد، انتقال جنینBackgroundThe use of assisted reproductive technology (ART) is increasing in the world. The rate, efficacy and safety of ART are very different among countries. There is an increase in the use of intra cytoplasmic sperm injection (ICSI), single fresh embryo transfer (ET) and frozen-thawed embryo transfer (FET).
ObjectiveThe objective of this study was to compare pregnancy rate in fresh ET and FET.
Materials And MethodsIn this retrospective cross-sectional study 1014 ICSI-ET cycles (426 fresh ET and 588 FET) from 753 women undergoing ICSI treatment referred to Fatemezahra Infertility and Reproductive Health Research Center in Babol, Iran from 2008 to 2013 were reviewed.
ResultsThere were no significant differences between biochemical pregnancy rate (23% versus 18.8%, OR 1.301; 95% CI. 95-1.774), gestational sac (95.6% versus 100% in FET, OR 0.60; 95% CI 0.54-0.67), and fetal heart activity (87.2% versus 93.6% OR. 46; 95% CI. 16-1.32) in fresh ET and FET cycles, respectively. P< 0.05 was considered statistically significant for all measures.
ConclusionAlthough, the result showed no significantly difference between the fresh ET and the FET cycles, however the embryos are able to be stored for subsequent ART. Therefore, we recommend FET cycles as an option alongside the fresh ET.
Keywords: Pregnancy rate, Intra cytoplasmic sperm injection, Cryopreservation, Embryo transfer -
کاهش کمیت و تحرک اسپرم از موارد اولیه ی ناباروری مردان می باشند. محققان نشان دادند که ژنNsun7 در تحرک اسپرم موش نقش دارد و جهش در این ژن می تواند باعث نقص در عملکرد پروتئین Nsun7 و ناباروری شود. این ژن در انسان دارای یک نقطه داغ جهشی در اگزون7 است. هدف این تحقیق مطالعه ی جهش های اگزون7 در مردان نورمواسپرمی و آستنوتراتواسپرمی می باشد. برای این منظور، تعداد 60 نمونه ی سمن شامل نمونه های بارور و نمونه های آستنوتراتواسپرمی از مرکز IVF جمع آوری شدند. آنالیز سمن براساس راهنمایی های WHO انجام شد. روش فنل-کلروفرم برای استخراج DNA اسپرم استفاده شد. قطعات اگزون7 با استفاده از دو پرایمر مستقیم Sun7-R: 5’- معکوس پرایمر و Sun7-F: 5’-GACAAATCTCGAAGTCTTGCTG ACATCCTATTTTTGTGAAAAGGGT تکثیر شدند. آنالیز توالی محصولات PCR جهش انتقالی C26232T را در مردان آستنوتراتواسپرمی نشان داد. این جهش در مردان بارور دیده نشد. پارامترهای کاهش یافته ی سمن مانند تحرک، از مردان آستنوتراتواسپرمی می تواند با این جهش مرتبط باشند. بنابراین، آنالیز اگزون7 ژنNsun7 می تواند کاندیدای یکی از مارکرهای تشخیص ژنتیکی در مردان نابارور باشد.
کلید واژگان: تحرک اسپرم، جهش انتقالی، مردان نابارور، آستنوتراتواسپرمی، Nsun7Reduced sperm quantity and motility are primary causes of infertility in men. Before researchers showed that, Nsun7 gene has roles in sperm motility of mouse, that creation defect in this gene is cause infertility. This gene in human located in chromosome 4, with 12 exons and a hot spot exon (exon7). Our aim is study of the mutations of the exon7 in the normospermic and asthenoteratospermic men. For this, 30 semen samples including fertile and asthenoteratospermic men were collected from IVF center. Semen analysis was performed according to WHO guidelines. A Phenol-chloroform method was used for total DNA extraction from sperm. The exons 7 amplified by forward primer Sun7-F: 5’-GACAAATCTCGAAGTCTTGCTG; and reverse primer Sun7-R: 5’-ACATCCTATTTTTGTGAAAAGGGT. The PCR products direct sequenced and analyzed for mutations. Analyses of PCR direct sequences showed transition mutation (C26232T) in asthenoteratospermic men. This mutation doesn't see in fertile men. We probably that, low semen parameters of the asthenoteratospermic men can be close correlate with these mutations. Thus, analyses of exon 7 direct sequence candidate as a one of diagnosis genetic markers of infertility.
Keywords: Nsun7, Sperm motility, Mutation, Infertile men, asthenoteratospermic -
سابقه و هدفنقص در DNA کروموزوم و یا میتوکندری، از دلایل ناباروری مردان است. ژنهای زیادی روی کروموزوم X و Y قرار دارند، که فرآیند اسپرماتوژنزیس را کنترل می کنند. ژن های کروموزوم Y، در تعیین جنسیت و فرآیند تولید مثل مردان نقش دارند. جهش یا اختلال در ژن های کروموزوم Y روی باروری مردان تاثیر می گذارد. در مطالعه حاضر، بیماری های ژنتیکی، نواحی جدید ژنی و آسیبهای جهشی در کروموزوم Y، بررسی می شوند.مواد و روش هادر یک مطالعه مروری، ناهنجاری های ژنتیکی ناشی از جهش های مولکولی کروموزوم Y بررسی شد. از مقالاتی در زمینه های پلی مورفیسم، روند غیر طبیعی اسپرماتوژنزیس، ارزیابی های ژنتیکی و آندروژن ها، استفاده گردید. حذف های میکروسکوپی، غیر طبیعی بودن کروموزومها، ژنتیک مولکولار و شرایط محیطی از جمله موضوعاتی بودند که مد نظر قرار گرفتند.یافته هااز 2000 ژن کنترل کننده فرآیند اسپرماتوژنزیس، تنها 30 ژن روی کروموزوم Y قرار دارند. شرایط محیطی، اختلالات ایمنی و هورمونی، آنتی اکسیدانها، عوامل ژنتیکی و کمبود عناصر مختلف، در ناباروری مردان موثر هستند. ناهنجاری های کروموزوم Y معمولا با حذف بعضی از فاکتورها همراه است. ژن های روی کروموزوم Y، در فرآیند اسپرماتوژنزیس و تکامل بیضه ها نقش دارند. جابجایی کروموزوم ها و از دست رفتن ماده ژنتیکی باعث ناباروری است. حذف میکروسکوپی معمولا به فرزند پسر منتقل شده و توان باروری فرد حتی با استفاده از تکنیک میکرواینجکشن نیز به راحتی قابل حل نخواهد بود. اثرات پلی مورفیسم ژن بر روی توانایی باروری مردان با کاهش در تعداد اسپرم همراه هست.نتیجه گیریبا شناخته شدن فاکتور آزواسپرمیک یا AZF در کروموزوم Y انسان، مشخص گردید که این ناحیه ژن های متعددی را در خود جای داده است. جهش یا حذف هر یک از این ژن ها، آسیب زیادی را روی فرایند اسپرماتوژنزیس و توانایی باروری در اسپرم انسان اعمال می کند.
کلید واژگان: ناباروری، اسپرم، ژن، کروموزوم Y، فاکتور با عامل آزوسپرمیکBackground And ObjectiveChromosomal or mitochondrial DNA abnormalities are the main causes of male infertility. So far, a lot of genes are identified on X and Y chromosomes that control the spermatogenesis process in a special order. Y chromosome genes have an important role in sex determination and male reproduction process, and so any mutation or disruption on the Y chromosome genes effects on male fertility. In this study, several kinds of genetic disorders and new area of gene and mutation damaging on the Y chromosome was investigated.MethodsIn this review article the genetic abnormalities induced by molecular mutations on Y chromosome was investigated.Papers pertaining to gene polymorphisms, abnormal spermatogenesis, genetic evaluation andandrogen receptor genes were used.Microdeletions, chromosomal abnormalities, molecular genetics, environmental conditions were also studied.FindingsAmong 2000 genes involved in spermatogenesis, only 30 genes are located on Y chromosome. Environmental condition, hormonal and immune disorders, antioxidants, genetic factors and elements deficiency are effective in male infertility. Y chromosome abnormalities usually associated with the removal of some factors. Genes on Y chromosome usually have an important role in spermatogenesis and testes development.Chromosomal translocation and loss of genetic material cause infertility. Microscopic deletion is usually transmitted to sons and their infertility cannot be solved even using the ICSI technique. Effect of genes polymorphism on male fertility is associated with a decrease in sperm count.ConclusionAzoospermic factor region on human Y chromosome contains a lot of genes which any mutation or deletion in these genes lead to impaired spermatogenesis and low sperm fertilization.Keywords: Infertility, Sperm, Genes, Y Chromosome, Azoospermic Factor (AZF) -
سابقه و هدفرحم جایگزین یعنی موافقت لازم با صاحب رحمی که اعلام آمادگی می نماید تا برای یک زوج نابارور، دوره بارداری را طی نموده و نوزاد را به آنها تحویل دهد. در رحم جایگزین، میزبان به طور کامل جانشین مادر واقعی شده و ممکن است فرزند مهمان، هیچ ارتباط ژنتیکی با مادر دوم خود نداشته باشد. مطالعه حاضر ابعاد حقوقی رحم جایگزین را با توجه به مسائل مربوط به ایران و کشورهای دیگر مورد بررسی قرار می دهد.مواد و روش هادر مطالعه حاضر از سایت های معتبر علمی مثل IranMedexو NCBI، در خصوص رحم جایگزین و روش های کمک باروری جستجوی لازم صورت پذیرفت. از مقالاتی که دیدگاه حقوقی نویسندگان نسبت به رحم جایگزین، مبتنی بر فقه اسلام به ویژه فقه شیعه بوده و توجهی به قوانین حقوقی مدنی و اجتماعی داخل نیز داشته اند، استفاده گردید. به مقالاتی در زمینه تحقیق، تتبع و جایگاه علمی رحم جایگزین و تاثیر آن در مسائل خانوادگی، استناد شد.یافته هادر رحم جایگزین، باید به عرف، قانون و مسائل اعتقادی هر جامعه توجه داشت. در اتریش، آلمان، سوئد، نروژ، یونان، ایرلند و فنلاند، استفاده از رحم جایگزین، یا غیرقانونی است و یا قانونی وجود ندارد. در ایران قانون خاصی تدوین نشده و متقاضیان بیشتر به فتاوی فقهای شیعه مراجعه کرده و در صورت مقلد بودن، از مرجع تقلید خود پیروی می نمایند. یا تابع مراکز ناباروری بوده و بر اساس دیدگاه آنها عمل می نمایند. در بعضی از کشور ها نیز به صورت تبرعی عمل شده و نفع و مصلحت کودک معیار است.نتیجه گیریعده ای این اقدام درمانی را برای طرفین مفید دانسته و معتقدند منع استفاده از رحم جایگزین باعث محدودیت برای بعضی از زوج های نابارور می شود. عده ای نیز خطر بکارگیری این روش را بیشتر از نفع آن می دانند. گرچه خلاء قانون به صورت فراگیر حس می شود، ولی درباره مسائلی مانند سرپرستی کودک، حقوق والدین و انگیزه انجام این کار، اختلاف نظرهایی وجود دارد.
کلید واژگان: ناباروری، رحم جایگزین، قانون، فقه اسلامIntroductionSurrogacy means necessary agreement with the womb owner who is ready for pregnancy and delivering the infant for an infertile couple. In a surrogacy، the host replaces the real mother totally and the guest child may not have any genetic relationship with his/her second mother. This study investigated the surrogacy legal dimensions according to the related issues of Iran and other countries.MethodsIn this study، necessary searches were used from scientific reliable sites such as Iran Medex and NCBI about surrogacy and ART methods. The articles with the author''s legal point of view toward surrogacy were used based on Islamic jurisprudence especially Shia jurisprudence that paid attention to Iranian civil legal and social laws. This study also was referred to the articles about scientific position of surrogacy and its'' effect on family problems.FindingsTradition، law and doctrinal issues of each society should be considered in a surrogacy. In some countries such as Astralia، Germany، Swedish، Norway، Greece، Irland and Finland، using of surrogacy is illegal or there is no law about this. Any specific law does not codified in Iran. Therefore، the applicants refer to shias jurists'' judgments and if they imitate of someone، they follow their Marja Taghlid. Alternatively، they follow up infertility centers and act based on their viewpoint. In some contries، the benefit of infant is more important.ConclusionSome people believe that this treatment is useful for both parties and that forbiddance of using surrogacy causes restriction for some infertile couples. Some people deem that the risk of using this method is more than its benefit. Although the vacancy of law feels universally، there is disagreement on some issues such as guardianship، parental rights and motivation of doing this work.Keywords: Infertility, Surrogacy, Law, Islamic law -
سابقه و هدفیکی از چالش های مهم عصر حاضر در علوم پزشکی، شبیه سازی انسان (Human Cloning) می باشد. این موضوع در میان پژوهشگران، فلاسفه اخلاق زیستی، عالمان دینی به ویژه فقهای شیعه و اهل سنت، سئوالات زیادی را به دنبال داشته است. از آنجایی که یکی از مهم ترین دلیل مخالفان شبیه سازی، تعارض و عدم سازگاری آن با کرامت انسانی است، این مطالعه به سازگاری و عدم تعارض شبیه سازی با کرامت انسانی، می پردازد.مواد و روش هابا طراحی این مطالعه بر اساس اطلاعات موجود، سعی شده تا کرامت انسانی با استفاده از آیات قرآن، احادیث، آراء عالمان دینی و الهی دانان، مورد ارزیابی قرار گیرد. همچنین از مقالاتی که در زمینه شبیه سازی نظراتی را ارائه کرده بودند، استفاده لازم صورت پذیرفت.یافته هااز نگاه قرآن کریم، انسان صاحب کرامت ذاتی است. شبیه سازی، شرایط یکسانی را در حفظ کرامت جنین با مراحل لقاح خارج رحمی دارد. هویت ژنتیکی یکسان، ناقض هویت شخصی فرد نخواهد بود. در شبیه سازی، انحصار سیستم ژنتیکی به چالش کشیده می شود و ارتباط خاصی به شخصیت کلی انسان ندارد. شکل گیری شخصیت فرد شبیه سازی شده در محیط زندگی، کرامت انسانی او را نیز صیانت می کند. هیچ یک از فقهای شیعه، نقض کرامت انسان را دال بر حرمت شبیه سازی، اعلام نکرده اند. شبیه سازی انسان مغایرتی با کرامت او ندارد.نتیجه گیریبا بررسی دقیق در مساله شبیه سازی، عدم تعارض آن با کرامت انسانی بدست می آید. ادله اخلاقی ارائه شده درمخالفت با شبیه سازی انسان، از اتقان لازم برخوردار نیست. به نظر می رسد دلیل محکم عقلی و نقلی در ناسازگاری شبیه سازی انسان با کرامت ذاتی او وجود ندارد.
کلید واژگان: قرآن، اخلاق، کرامت انسانی، شبیه سازیIntroductionOne of the important challenges in medical sciences is human cloning nowadays. This subject makes many questions among the researches، bioethics philosophers، religious scholars especially Shia and Sunni jurists. Since one of the most important reason of human cloning opponents is its conflict and incompatibility with human munificence. This study aimed at investigating the adaptability and the lack of conflict between human cloning and munificence.MethodsThis study had been designed to evaluate the human munificence by using Quran، Traditions and the ideas of Religious Scholars and Theologians. In addition، the articles that had been presented comments on cloning were used in the present study.FindingsFrom Quran point of view، the human being possesses inherent munificence. Cloning has the same situation in protection of embryo munificence with extra uterine fertilization process. The same genetic identity is not adversative of individual identity. In the cloning، the restriction of genetic system has been challenged and has not specific relationship with the general character of human. The formation of personality of cloning person in the environment protects human munificence. None of the Shia jurists has declared that cloning is the evidence of violation of human munificence. Human cloning has not conflict with his munificence.ConclusionThe lack of conflict between cloning and munificence were obtained by exact investigation about this. Moral reasons that disagree with human cloning are not firm. It seems that there are not the traditional and rational reasons in incompatibility of human cloning with his inherent munificence.Keywords: Quran, Cloning, Organism, Islam, Personhood -
سابقه و هدفسقط به ختم حاملگی قبل از هفته بیستم، اطلاق می شود. سالانه حدود 80 هزار سقط در ایران انجام می پذیرد. بسیاری از مسائل اجتماعی مانند داشتن فرزند زیاد، عدم تقارن در جنسیت، بارداری های ناخواسته و یا نامشروع بودن فرزند، زمینه مساعدی را برای سقط جنین فراهم نموده است. مکاتب مختلف دیدگاه ها و ایده های گوناگونی ارائه کرده اند. اسلام نیز به دلیل کرامتی که برای انسان در نظر گرفته، حتی برای مرحله انعقاد نطفه و قبل از دمیده شدن روح، ارزش خاصی قائل است. این مطالعه به دیدگاه اسلام، مخصوصا از منظر فقه شیعه، به موضوع سقط جنین می پردازد.مواد و روش هادر این مطالعه، فتاوی عمده فقها و علمای معاصر شیعه، نظر فقهی حضرت امام خمینی و حضرت آیه الله خامنه ای و همچنین دیدگاه نگارنده در خصوص سقط جنین انسان، مورد بحث و بررسی قرار گرفت. به احادیثی از پیامبر اسلام و آیات قرآن استناد شد. دیدگاه مکاتب مختلف اهل سنت، آیین یهودیت، آموزه های زرتشت و الهی دانان مسیحی نیز مد نظر قرار گرفت. ایده و آراء مکاتب غیر الهی مانند فمنیست ها، نگاه علمی متخصصین پزشکی و همچنین دلایل عقلی و عرفی، نیز از جمله مواردی بودند که در این تحقیق به آنها توجه گردید.یافته هاقاطبه فقهای اسلام، سقط جنین را در هر مرحله از تکون، در صورتی که دلیل موجهی برای آن وجود نداشته باشد، حرام و غیر شرعی می دانند. براساس قاعده نفی عسر و حرج، حرمت سقط در شرایطی منتفی بوده و باید از ضرر بزرگتر جلوگیری کرد و اساس آن قاعده تقدم اهم بر مهم است. با مزاحمت جنین در رحم، دلیل متقنی وجود ندارد تا بتوان با استناد به آن، حق حیات را از مادر سلب نمود. در مزاحمت حیات جنین با ادامه حیات مادر، سقط جنین برای مادر مجاز خواهد بود. با قاعده نفی حرج حکم حرمت برداشته می شود و قاعده نفی حرج، بر همه احکام از جمله تقیه حکومت دارد.نتیجه گیریحرمت سقط جنین از دیدگاه اکثر فقها، یک مسئله مطلق نبوده و استثناء پذیر است. براساس قاعده نفی عسر و حرج، حکم حرمت سقط جنین برداشته می شود. مزاحمت جنین با حیات مادر نیز می تواند مجوزی برای سقط جنین باشد. توجه به آموزه های دینی و فقه شیعه، تبیین کننده راه درست خواهد بود.
کلید واژگان: انسان، سقط جنین، اسلام، فقه شیعه، حرمتIntroductionAbortion is the termination of pregnancy before the twentieth week. About 80 thousand abortions are annually performed in Iran. Many social issues such as having many children، asymmetry in sex، unintended pregnancy، or being illegitimate child have provided appropriate ground for abortion. Different schools have offered a variety of views and ideas. The conception phase and the stage before the soul is inspirited are of value to Islam due to the dignity of man. This study investigated the issue of abortion from the perspective of Islam especially Shi''a jurisprudence.MethodsThe religious verdicts of jurisconsult and Shia contemporary scholars، the religious jurisprudence ideas of Imam Khomeini and Ayatollah Ali Khamenei and the author''s perspective on human abortion were discussed and evaluated in this study. The traditions of Muhammad and the signs of Quran were also cited in the present study. The approach of different schools of Sunni، Judaism، the teachings of Zoroaster and Christian theologians were considered. The ideas of non-divine schools like feminists، the science view of medical specialists and the intellectual and common language reasons were addressed in this study.FindingsThe majority of Islamic jurisconsults believes that the abortion at any stage of the live is prohibited and is considered non-religious if there is no good reason for it. Abortion sanctity in some circumstances is prohibited according to the negation of hardship and sin rules and it should be prevented from the greater loss based on importance and priority rule. There is no strong reason to abort the pregnancy because of its harassment in the womb. Abortion is permissible for mother if the life of mother is at risk. The sanctity of the rule is removed by the negation of sin rule. The negation of sin rule is dominant on all provisions like dissimulation.ConclusionThe sanctity of abortion is not absolute and has exception from the perspective of the majority of Islamic jurisconsults. The sanctity of abortion is removed according to the negation of hardship and sin rules. The harassment of pregnancy in the womb، which leads to danger of mother’s life، can be licensed for abortion. The religious teachings and Shia jurisprudence determine the right way.Keywords: Humane, Abortion, Islam, Shia jurisprudence, Value of Life, Babol University of Medical Sciences -
زمینه و هدفسموم کشاورزی از خانواده ارگانوکلره و یا ارگانوفسفره عوارض مختلفی را بر بافت های بدن ایجاد می نمایند. این مطالعه به منظور اثر دیازینون به عنوان یک حشره کش ارگانوفسفره غیرسیستمیک بر هورمون های جنسی و سایتوکاین های اینترفرون گاما، اینترلوکین 4 و 10در موش های صحرایی نر انجام شد.روش بررسیدر این مطالعه تجربی 24 سر موش صحرایی نر بالغ نژاد ویستار به طور تصادفی در چهار گروه قرار گرفتند. سه گروه آزمایشی به مدت 5 روز در هفته سم دیازینون را به مدت یک ماه و با دوز (30، 3، 0.3 mg/kg/bw)به صورت داخل صفاقی دریافت کردند. گروه کنترل تزریقی نداشتند. هفت روز بعد از آخرین تزریق، سطح سرمی هورمون های تستوسترون، FSH،LH و سایتوکاین های اینترفرون گاما، اینترلوکین 4 و 10 اندازه گیری شدند.یافته هااینترلوکین 10 در گروه آزمایشی(30 mg/kg/bw)نسبت به گروه کنترل افزایش آماری معنی دار و در گروه های آزمایشی3 mg/kg/bw و 0.3 mg/kg/bw کاهش آماری معنی داری یافت (P<0.05). اینترلوکین-4 تنها در گروهی که سم دیازینون را با دوز 30 میلی گرم بر کیلوگرم دریافت کرده بودند؛ معنی دار بود (P<0.05). کاهش اینترفرون گاما بین گروه های آزمایشی و کنترل از نظر آماری معنی دار نبود. میزان هورمون FSH در سه گروه آزمایشی نسبت به گروه کنترل دارای کاهش معنی داری بود (P<0.05). همچنین هورمون تستوسترون در گروه های آزمایشی نسبت به گروه کنترل افزایش معنی داری یافت (P<0.05).نتیجه گیریدیازینون سبب افزایش معنی دار سطح اینترلوکین 10 و افزایش تستوسترون و کاهش هورمون FSH موش صحرایی می گردد.
کلید واژگان: دیازینون، اینترلوکین 10، FSH، LH، تستوسترون، موش صحراییBackground And ObjectiveAgricultural toxins including organochlorine and organophosphorus families cause damages in the various tissues in humans. Diazinon is a non-systemic organophosphate insecticide. This study was carried out to determine the effect of Diazinon on sex hormone، interferon gamma، interleukin-4 and 10 in male rats.MethodsIn this experimental study 24 adult male Wistar rats were randomly allocated into four groups. Three experimental groups were received Diazinon 5 days per week for one month at 0. 3، 3 and 30 mg/kg/bw intraperitoneally، while controls received nothing. Seven days after the last injection، blood samples were obtained and the serum testosterone، FSH، LH، interferon gamma، interleukin-4 and interleukin-10 were measured.ResultsSerum level of Interleukin-10 significantly increased in experimental group (30 mg/kg/bw of Diazinon) compared to controls (P<0. 05). Serum level of Interleukin-10 significantly decreased in 0. 3 mg/kg/bw and 3mg/kg/bw of Diazinon groups compared to controls (P<0. 05). Interleukin-4 level was only significant in the group receiving 30 mg/kg/bw of Diazinon (P<0. 05). Reduction in interferon-gamma level was not significant between control and experimental groups. FSH significantly reduced in the three experimental groups in comparison with controls (P<0. 05). Testosterone level was significantly increased in experimental groups compared to control (P<0. 05).ConclusionDiazinon increases interleukin-10 and testosterone and reduces FSH hormone in the rat.Keywords: Diazinon, Interleukin, 10, FSH, LH, Testosterone, Rat -
سابقه و هدفدورسبان (کلروپیریفوس)، از متداول ترین سموم ارگانوفسفره ای است که برای کنترل آفت گیاهان مورد استفاده قرار می گیرد. مکانیسم اصلی این گونه ترکیبات، مهار آنزیم کولین استراز بوده و ممکن است بر روی سیستم تولید مثلی، تاثیر منفی داشته باشند. با توجه به استفاده آن در کشاورزی و ضرر احتمالی این سم، تاثیر آن بر روی هورمون های جنسی و تغییرات بافتی در بیضه موش سفید کوچک مورد مطالعه قرار گرفت.مواد و روش هادر یک مطالعه تجربی، 40 سر موش نر بالغ آزمایشگاهی به چهار گروه مساوی شامل کنترل، شم، آزمایشی1 و 2 تقسیم شدند. حیوانات در گروه های تجربی، سم دورسبان را با دوز مکررmg/kg 15 وmg/kg 30 به صورت داخل صفاقی به مدت یک ماه (پنج روز اول هفته) دریافت نمودند. به گروه شم روغن زیتون تزریق گردید. گروه کنترل تزریقی نداشتند. با تهیه برش های بافتی از بیضه، رده های مختلف سلولهای اسپرماتوژنیک و سلولهای لایدیگ و قطر لوله های اسپرم ساز با استفاده از عدسی چشمی مدرج اندازه گیری شدند. قطر بیضه نیز توسط میکرومتر اندازه گیری شد. هورمون های گونادوتروپین و تستوسترون با استفاده از روش radioimmunoassay بدست آمدند. سپس داده ها تجزیه و تحلیل شدند.یافته هامیزان هورمون های گونادوتروپین و تستوسترون در گروه های آزمایشی 1 و 2، کاهش معنی داری نسبت به گروه کنترل و شم پیدا نمود (05/0p<). تعداد سلولهای اسپرماتوگونی، اسپرماتوسیت های اولیه و ثانویه، اسپرماتیدها و سلولهای لایدیگ، قطر بیضه و قطر لوله های اسپرم ساز نیز کاهش معنی داری را در گروه های آزمایشی 1 و 2، نسبت به گروه کنترل و شم و همچنین در گروه آزمایشی2 نسبت به گروه آزمایشی 1، نشان داد (05/0p<).نتیجه گیرینتایج این مطالعه نشان داد که احتمالا سم دورسبان، می تواند باعث کاهش هورمون های جنسی شده و با تخریب بافت بیضه، یکی از عوامل ناباروری تلقی گردد.
کلید واژگان: دورسبان، بافت بیضه، اسپرماتوگونی تستوسترون، گنادوتروپینBackground And ObjectiveDursban is the most common organophosphate pesticides that used for control of pests. The main action of this compound is inhibition of cholinesterase enzyme، which adversely effects on reproductive system. Due to the use of pesticides in agriculture and the possible damage، the effect of this toxin on the sexual hormones and changes of testis tissue in mice was studied.MethodsIn the experimental study، 40 adult male mice were divided into four equal groups including control، sham، experimental (1and 2) groups. In the experimental groups، animals were intraperitoneally injected with consecutive doses of 15mg/kg and 30mg/kg dursban for one month (five days per week). The olive oil was injected to sham group and control received no injection. Testes tissue sections were prepared to investigate possible changes occurring in the category of spermatogenic، Leydig cells and seminiferous tubule by eye piece (calibrated ocular lens). Diameter of testis was measured by micrometer. Levels of gonadotropin hormones and testosterone were assayed by radioimmunoassay. Then data were analyzed.FindingsLevels of gonadotropin hormones and testosterone in experimental (1 and 2) groups were significantly declined compared to control and sham group (p<0. 05). The number of spermatogonia، primary and secondary spermatocyts، spermatids، Leydig cells، diameter of testis and seminiferous tubule diameter in the experimental (1 and 2) groups compared to control and sham group and also in the experimental 2 group compared to experimental 1 group were decreased (p<0. 05).ConclusionThese results demonstrated that dursban can cause the decrease of sexual hormones and damage of testes tissue that is pushing people toward infertility.Keywords: Dursban, testis tissue, Spermatogonia, Testosterone, Gonadotropin -
سابقه و هدفبا شکل پذیری اسپرم در زمان بلوغ، آنتی ژن روی آنها، همانند یک سلول بیگانه در برابر سیستم ایمنی، عمل می کند. با وارد شدن اسپرم به داخل سیستم عروق خونی، آنتی ژنها در معرض سیستم ایمنی بدن قرار گرفته و باعث تولید آنتی اسپرم آنتی بادی می شوند. این مطالعه به منظور بررسی تاثیر دریافت داخل صفاقی اسپرم، بر روی بافت بیضه رت در نسل دوم انجام شد.مواد و روش هااین مطالعه به صورت تجربی، آزمایشگاهی بر روی رتهای بالغ از نژاد آلبینوس که حدود 3 ماه سن و وزنی برابر300 -250 گرم داشتند، انجام شد. اسپرم های بدست آمده از 8 سر رت های نر، به صورت داخل صفاتی به 12 سر رتهای ماده، طی چهار مرحله و با رعایت فاصله یک هفته، تزریق شد. سپس تحت شرایط Coupling، از بافت بیضه فرزندان تولد یافته نر (24 سر از نسل دوم) بعد از رسیدن به سن بلوغ، نمونه برداری صورت گرفت. با تهیه برش های بافتی و رنگ آمیزیH&E، قطر مجاری اسپرم ساز، تعداد سلولهای ژرمینال و سلولهای لایدیگ با استفاده از صفحه مدرج اندازه گیری شده و با گروه کنترل مقایسه گردید.یافته هامیانگین تعداد سلولهای ژرمینال، در نمونه های کنترل و نسل دوم به ترتیب 9/0±5/9 و 1/1±2/8 بود (001/0p<). میانگین سلولهای لایدیگ نیز، 74/2±63/7 در گروه کنترل و 21/2±55/6 در رت های نسل دوم شمارش گردیدند (001/0p<). قطر مجاری اسپرم ساز در نسل دوم بطور معنی داری (47/0±7/3)، بیشتر از گروه کنترل (025/0±62/1) بدست آمد (001/0p<).نتیجه گیرینتایج مطالعه نشان داد که تزریق داخل صفاقی اسپرم (آنتی ژن) در بدن رت مادر، می تواند باعث افزایش قطر مجاری اسپرم ساز، کاهش سلولهای ژرمینال و کاهش سلولهای لایدیگ در فرزندان آنها شود.
کلید واژگان: آنتی اسپرم آنتی بادی، بافت بیضه، جنین، رتBackground And ObjectiveWhen the sperm finds its final form at maturity، its antigen acts as a foreign cell against an immune system. With the sperm entrance into the blood vessel system، the immune system is exposed to antigens، and anti-sperm antibodies can be produced. The aim of this study was to evaluate the effect of intraperitoneal sperm injection on rat testis tissue in second generation.MethodsThis experimental- laboratory study was performed on adult Albino rats of 3 months of age and weight approximately 250 to 300 grams. Sperms obtained from 8 rats، were injected into 12 female rats، during 4 stages at one week interval. Then under coupling، the testes of male offspring born (24 rats of the second generation) were biopsied after reaching the age of maturity. Tissue slices were prepared and stained with H&E. Seminiferous tubule diameter، number of germ cells and leydig cells were measured by using the eyepiece and compared with control group.FindingsAverage number of germ cells in control and second generation was 9. 5±0. 9 and 8. 2±1. 1، respectively (p<0. 001). Average leydig cells were counted 7. 63±2. 74 in the control group and 6. 55±2. 21 in second generation rats (p<0. 001). Diameter of seminiferous tubules in the second generation (3. 7±0. 47) was significantly higher than the control group (1. 62±0. 025) (p<0. 001).ConclusionIntraperitoneal injection of sperm (antigens) in the body of the mother rats can cause changes including the increase in seminiferous tubule diameter and decrease in germ cells and leydig cells in their offspring.Keywords: Antisperm antibody, Testis tissue, Embryo, Rat -
سابقه و هدف
پایین آمدن قدرت تحمل بشر امروزی در برابر درد و بهره گیری از اشیاء تسهیل کننده مرگ، امکان زنده نگه داشتن طولانی مدت بیماران صعب العلاج و همچنین استفاده از اعضاء بدن افراد دچار مرگ مغزی برای پیوند، باعث گردیده تا توجه بیشتری نسبت به انتخاب قتل نفس یا اتانازی شود. این مطالعه به بررسی قتل نفس انتخابی یا اتانازی از دیدگاه فقه اسلامی می پردازد.
روش کاراین مطالعه با بررسی قوانین کشور های مختلف و فتاوی عمده فقها و علمای معاصر شیعه در خصوص قتل نفس یا اتانازی، انجام شد. همچنین از تحقیق و تتبع در آیات قرآن و روایات و نیز فتاوی فقها نیز برای دستیابی به یک نتیجه متقن و مستدل استفاده گردید.
یافته هاقرآن کشتن یک فرد را معادل کشتن همه انسان ها به حساب می آورد. بر اساس یک تکلیف الزامی و الهی، قتل نفس و یا کشتن دیگران از گناهان کبیره است. مرگ پرهیز از درمان، در نگاه عرف و عقل، خودکشی نیست. امتناع پزشک از درمان بیمار، قتل نفس به حساب نیامده و قصاص و دیه ای بر آن جاری نیست. ولی به دلیل کوتاهی در حفظ جان یک مسلمان، گناه بزرگی مرتکب شده است. در اتانازی صرف دلسوزی و راحت نمودن بیمار، مانع صدق قتل نفس نشده و چنین کاری شرعا ناروا و حرام است. اگر قتل نفس با اذن و رضایت بیمار باشد، قصاص و دیه ای ندارد. در خصوص قتل مرگ مغزی، برابر نظر بعضی از فقها، بیمار مرده به حساب می آید. عده ای هم، دلیل ذکر شده را کافی نمی دانند. دیدگاه بعضی از کشورها با قبول اتانازی در حمایت قانون که متاثر از دیدگاه های علمی دانشمندان آنها است، بدون در نظر داشتن جنبه های اعتقادی آنها بیان گردید.
نتیجه گیرینتایج مطالعه نشان داد که اتانازی یا قتل نفس از روی ترحم و یا پرهیز از درمان، بدون اطلاع فرد و یا با تقاضای او و حتی اکراه و تهدید نیز، مجاز نخواهد بود.
کلید واژگان: قتل نفس، قصاص، دیه، اسلامBackground And ObjectiveChoice of Suicide or euthanasia is among the new issues that with respect to descriptive judgments and deontological judgment require an exclusive research. Human suffering and pain and utilization of drugs، enabling more patients to keep alive long term. The use of organs for transplant patients with brain death، causing more attention than it has been found to be.
MethodsIn a retrospective study، the laws of different countries and leading jurists، the view contemporary Shia scholars and their Fatwa on man killing or euthanasia in humans were discussed. The opinions and views on euthanasia in some countries that had supported the law were evaluated. Some countries do not consider issues not believe in euthanasia. Hadiths and verses from the Quran، it is manslaughter. In these verses، hadith and jurists fatwa has been used to achieve results.
FindingsAccording to Quranic perspective and divine command، manslaughter، or killing others is considered a significant sin. As Quran teaches us، killing an individual is equivalent to killing all humans. Treatment to avoid death، according to common view and reason، is not considered a suicide. The avoidance of a physician for treating a patient is not regarded murder therefore it does not conclude to any redemption or compensation، but he still is considered a sinful person due to his failure to save Muslim `life. Euthanasia to a patient in a caring and comfortable، and do not prevent the murder of truth is religiously impermissible and unlawful. And patient satisfaction is with the permission of the murder، retribution and blood money is not flowing. The killing of brain death، the opinion of some jurists، the patient is considered dead. Some also mentioned the reason they do not know enough.
ConclusionThe research done in this paper reveal that euthanasia or merciful killing or avoiding treating، a patient without noticing him/her or even with his/her demand، or reluctantly and even threatened him as well، would not be permitted.
Keywords: Euthanasia, Retribution, Blood money, Islamic -
سابقه و هدفتشریح یا کالبد شناسی، به معنای جدا کردن اعضای مردگان، جهت آموزش علم پزشکی می باشد. گرچه کالبد شکافی از موضوعاتی است که باعث پیشرفت دانش پزشکی است. اما این بحث در میان فقهای گذشته به عنوان یک بحث جدی مطرح نبود. این مطالعه، مبتنی بر دیدگاه اسلام در موضوعات نو پدید،که همان اجتهاد پویای اسلام است، به بحث و بررسی پیرامون تشریح می پردازد.روش کاراین مطالعه با مرور، فتاوی عمده فقها و علمای معاصر شیعه در خصوص تشریح یا کالبد شکافی انسان انجام شد. از تفاسیر، به عنوان دست مایه اصلی برای استنباط موضوع استفاد گردید. استفاده از روایات که در زمینه مثله کردن، تعجیل در تجهیز میت و حرمت جسد مسلمان و کافر بیان شده، به بحث کشیده شد.یافته هافقها نوعا به حرمت کالبد شکافی فتوا می دهند و جز در صورت تزاحم با واجب اهم، آن را جایز نمی دانند. اگر تشریح با انگیزه عقلایی و خیرخواهانه انجام گیرد، هتک حرمت صدق پیدا نکرده و حرمت تشریح و پرداخت دیه ساقط می شود. تشریح با هدف حفظ جان مسلمان، آموزش علم پزشکی، تشخیص و درمان بیماری، به معنای مثله کردن نیست. تشریح با اصل تجهیز میت منافاتی ندارد. می توان میت را غسل داد و بر او نماز خواند و بعد از تشریح دفن کرد. حاکم اسلامی می تواند بر انجام تشریح حکم کند.نتیجه گیریتشریح در صورت تزاحم با واجب اهم، انگیزه عقلایی و خیرخواهانه، حفظ جان مسلمان، آموزش علم پزشکی، تشخیص و درمان بیماری و با دستور حاکم اسلامی، جائز خواهد بود.
کلید واژگان: تشریح، دیه، فقه اسلامی، علوم پزشکیBackground And ObjectiveAnatomy or dissection is separation of dead body and its parts، as a common way for training medical students or diagnosing the disease and identifying damages. Although dissection is an issue that، led to the development of medical science، but the debate was not a serious topic for scholars of past Jurists. This study is based on Islamic perspectives regarding new issues called as dynamic Islamic Ijtihad، and it analysis discussion on dissection.MethodsIn a review، the majority of contemporary Shia jurisprudence`s Fatwa regarding dissection or anatomy was analyzed. Interpretative sources were used as the motif to infer the subject. Using narrations with connection to rush of a body، hurrying to equip the dead body، and the sanctity of dead body of Muslim and pagan is pointed out and were subject to careful discussions.FindingsJuristic Fatwa usually forbidden dissection and they don’t permit it unless there happen a contradiction. If the dissection is performed with good will and charitable intention it wouldn’t be considered a case of disrespecting therefore the sanctity of dissection، and paying redemption is rejected. Dissection with the aim of preserving Muslim lives، education، medicine، diagnosis and treatment، is not equal to mutilation. Dissection dose not conflict with the principle of burring the dead body and it could be washed، being prayed and finally be buried. The supreme religious leader could bid for dissection.ConclusionDissection is allowed in case of encountering a critical conditions with، intellectual and charitable motives، saving for the Muslim''s life، using in education، medicine، diagnosis and treatment of disease.Keywords: Dissection, Diego, Islamic jurisprudence, Medical science -
سابقه و هدففاکتورهای متعددی بر توانایی بارورسازی اسپرم تاثیر می گذارند. سمن هیپرویسکوزیته یکی از دلایل ایدیوپاتیک اختلال در حیات و عمکلرد اسپرم می باشد. احتمال میرود یکی از دلایل تاثیر هیپرویسکوز بر روی عملکرد اسپرم، کاهش فعالیت آنتی اکسیدانی مایع سمینال باشد. لذا این مطالعه به منظور مقایسه فعالیت آنتی اکسیدانهای تام در مایع سمینال مردان هیپرویسکوز با غیرهیپرویسکوز انجام شد.مواد و روش هااین مطالعه مقطعی بر روی 47 نمونه سمن از مردان نابارور هیپرویسکوز (22=n) و غیر هیپرویسکوز (25=n)، مراجعه کننده به مرکز باروری و ناباروری فاطمه الزهرا (ص) بابل انجام شد. پس از تعیین ویسکوزیته سمن با اندازه گیری روش کشش سطحی سمن، پارامترهای اسپرم (شامل حجم، تعداد، حرکت و موروفولوژی طبیعی) با استفاده از روش های میکروسکوپی مورد مطالعه قرار گرفتند. فعالیت آنتی اکسیدانهای تام در مایع سمینال تمام نمونه ها به روش FRAP اندازه گیری و مقایسه شدند.یافته هامیانگین پارامترهای اسپرم، شامل تعداد (35/25±32/29)، حرکت (11/19±95/30) و مورفولوژی طبیعی (5/2±23/4)، در گروه هیپرویسکوز به طور معنی داری، کمتر از گروه غیرهیپرویسکوز (تعداد 29/26±80/46، حرکت 41/15±8/52 و مورفولوژی طبیعی 16/3±56/7) بود (به ترتیب با 02/0>p و 001/0>pو 001/0>p). همچنین میانگین غلظت آنتی اکسیدانهای تام در مایع سمینال گروه هیپرویسکوز (μmol/l 1230.25±325) به طور معنی داری کمتر از گروه غیرهیپرویسکوز (μmol/l 1710.31±458.67) بدست آمد (01/0>p).نتیجه گیرینتیجه حاصل از این تحقیق نشان داد که بین فعالیت آنتی اکسیدانهای تام در مایع سمینال و کیفیت پارامترهای اسپرمی، ارتباط نزدیکی وجود دارد. کاهش فعالیت آنتی اکسیدانهای تام در مایع سمینال مردان هیپرویسکوز احتمالا یکی از مکانیسم های دخیل در کاهش کیفیت اسپرمی در این افراد می باشد.
کلید واژگان: سمن هیپرویسکوز، آنتی اکسیدان مایع سمینال، ناباروریBackground And ObjectiveSeveral factors have influence on sperm fertilization, between them semen hyperviscosity is one of the idiopathic factors involved in sperm viability and function deficiency. Probably, decrease in human seminal antioxidants is one of the negative effects of hyperviscosity on sperm function. The aim of this study was to compare the total antioxidant activity (TAC) in seminal plasma of infertile patients with hyperviscosity and non- hyperviscosity.MethodsIn this cross sectional study, 47 semen samples were provided from infertile patients with hyperviscosity (n=22) and without hyperviscosity (n=25) at Fatemeh Zahra Infertility and Health Reproductive Research Center. After determine the semen hyperviscosity by measuring the length of the thread on withdrawal of the rod, sperm parameters (volume, sperm counts, motility and normal morphology) were evaluated on microscopic examination. TAC was measured in all samples by FRAP method and compared.FindingsThe mean of sperm parameters including: counts (29.32 ± 25.35), motility (30.95 ± 19.11) and normal morphology (4.23 ± 2.5) in patients with hyperviscosity were significantly lower than those in non-hyperviscosity patients (counts 46.80 ± 26.29, motility (52.8 ± 15.41) and normal morphology (7.56 ± 3.16)) (p<0.02, p<0.001 and p<0.001, respectively). The mean of TAC in seminal plasma of non- hyperviscosity patients (1710.31 ± 458.67µmol/l) was significantly higher than that of hyperviscosity group (1230.25 ± 352 µmol/l) (p<0.01).ConclusionOur results showed that there is a positive significant correlation between TAC and sperm parameters quality. Decrease in TAC concentration in seminal plasma of patients with hyperviscosity is one of the probability mechanisms for sperm parameters abnormality.Keywords: Semen hyperviscosity, Seminal antioxidants, Infertility
- در این صفحه نام مورد نظر در اسامی نویسندگان مقالات جستجو میشود. ممکن است نتایج شامل مطالب نویسندگان هم نام و حتی در رشتههای مختلف باشد.
- همه مقالات ترجمه فارسی یا انگلیسی ندارند پس ممکن است مقالاتی باشند که نام نویسنده مورد نظر شما به صورت معادل فارسی یا انگلیسی آن درج شده باشد. در صفحه جستجوی پیشرفته میتوانید همزمان نام فارسی و انگلیسی نویسنده را درج نمایید.
- در صورتی که میخواهید جستجو را با شرایط متفاوت تکرار کنید به صفحه جستجوی پیشرفته مطالب نشریات مراجعه کنید.