m. zakiaghl

Citrus tristeza virus (CTV) is one of the most devastating citrus diseases in Iran. The CTV genome is a positive single-stranded RNA molecule with a size of 19.3 kb containing 12 open reading frames (ORFs). CTV encodes two different coat proteins, of which the small coat protein (CPm) covers only the 3' end of the genome. CTV infected trees show symptoms such as stunting, yellows, reduced vigor and death. In addition, CTV generates three typical disease syndromes, including quick decline, stem pitting and seedling yellows. In total, more than 259 thousand hectares of citrus are grown in the north and south of Iran. Considering the lack of the complete genome sequence of Iranian CTV isolates and the different climatic conditions in citrus cultivation in the north and south of Iran, the genome of CTV isolates from Iran was determined for the first time and their phylogenetic relationships with other CTV isolates were studied.

In spring and fall 2015, 30 samples from Mazandaran province in northern Iran and 25 samples from Fars province in southern Iran were collected from trees suspected of being infected with CTVs. Total RNA was extracted using the RNX-Plus kit according to the manufacturer's instructions. CTV was identified using the specific primer pair CPF (5¢AAAGAAGGCGACGATGTTGT3¢) and CPR (5¢AGCTCCGGTCCAAGAAATCTG3¢) designed based on the coat protein gene of CTV. Reverse transcription was performed using MMuLV reverse transcriptase (Pars Tuos, Iran) and PCR reaction was performed using Amplicon 2x PCR Master Mix (Amplicon, Denmark). Infected samples were grafted onto sour orange seedlings. sRNAs were extracted using a protocol developed by Carra et al. (2006), and sRNA libraries were prepared according to the CATS protocol (Turchinovich et al., 2014). One microgram of each library was sequenced on the Illumina HiSeq2500 platform from Macrogen, South Korea. The CTV strains were determined by virtual replication and digestion or alignment of the region between the small coat protein (Cpm) and coat protein (Cp) genes. The phylogenetic tree was constructed by the maximum likelihood method using the T92+I nucleotide substitution model with 500 bootstrap repeats by MEGA7. The nucleotide and amino acid similarity matrix was calculated using SDTv.1.2 software. Potential recombination events in the genome were determined using RDP v.5.5.

CTV infection was detected in 17 samples from Mazandaran province (56% of samples) and in 8 samples from Fars province (33% of samples) using a CPF/R-specific primer pair. CTV symptoms were mild to severe stunting, chlorosis, yellowing, vein yellowing, and severe decline in the citrus samples from the north of Iran, while CTV symptoms in the samples from the south of Iran were stunting, chlorosis, dieback and quick decline. Three months post inoculation, symptoms of severe stunting and chlorosis appeared in seedlings inoculated with isolates from the north, while mild stunting and yellowing appeared in seedlings of sour orange inoculated with CTV isolates from the south. By assembling the contigs obtained from the RNA-seq data, the complete genomes of IR-North1, IR-North2, IR-South1, and IR-South2 isolates were reconstructed with lengths of 19296, 19302, 19252, and 19251 nucleotides, respectively. The Iranian CTV isolates had nucleotide similarity in the range of 95.2-77.5% with other CTV isolates deposited in GenBank. The polymerase, P65, and coat protein genes of the Iranian CTV isolates showed identity at the amino acid level of 80.6-94.1%, 88-93.9%, and 92.4-96.4%, respectively, with other CTV isolates. Analysis of the CTV strains revealed that IR-North1 resembles the severe decline strain belonging to genotypic group T36, while IR-South2, IR-North2, and IR-South1 belong to the stem pitting and seedling yellows strains of genotypic group VT/T3 and are similar to strains T3, SY, and T318A, respectively. In the phylogenetic tree based on the full length of the CTV genome, three subclades were designated: VT, T68, and T36. IR-North2, IR-South1, and IR-South2 isolates were grouped into VT, and IR-North1 isolate was grouped into T36. Like the reference CTV isolate, the four Iranian CTV isolates had 12 open reading frames. Examination of the Replicase, RdRp, P65, P61, CPm, and CP proteins revealed 280 amino acid substitutions in 33 conserved motifs in Iranian CTV isolates. The isolate IR-North1 had only five substitutions; however, 97, 85, and 93 substitutions occurred in the isolates IR-North2, IR-South1, and IR-South2, respectively. Most substitutions were found in the replicase and p61 proteins, which are involved in virus replication and assembly, respectively. RdRp and p23 proteins had the least amino acid substitutions. No known conserved motif was observed in P33, P6, P18, P13, and P20 proteins. In addition, IR-North1, IR-North2, and IR-South1 were recombinant. In IR-North1, 1426 nucleotides in the P65 gene and 773 and 2444 nucleotides in the replicase gene were recombinant in IR-North2 and IR-South1 isolates, respectively.

An analysis of symptoms, nucleotide diversity, dominant strains, and the phylogenetic relationship of the four Iranian CTV isolates sequenced in this study revealed that two isolates from northern Iran were quick decline and seedling yellows strains, falling within the genotypic groups T36 and VT. These groups were distinguished by distinct symptoms and a separate phylogenetic position. Conversely, the two southern CTV isolates were closely associated with CTV stem pitting strains, classified into genotypic groups VT and T3, sharing a close phylogenetic position.

Beet curly top disease is one of the most important sugar beet viral diseases. Numbers of viruses in the family Geminiviridae, including Beet Curly Top Iran Virus (BCTIrV), Beet Curly Top Virus (BCTV), and Turnip Curly Top Virus (TCTV) have generated curly top symptoms in sugar beet. BCTIrV belongs to the genus Becurtovirus, but BCTV and TCTV put in Curtovirus and Turncurtovirus genera, respectively. BCTIrV is known as the most prevalent causal agent of curly top disease in Iran. It has circular single-stranded DNA genomes with 2.8–3.2 kb nucleotides length. The genome encapsidate in quasiicosahedral twinned particle with 22 nm diameters. BCTIrV is transmitted by Circulifer Haematoceps leafhopper naturally. Non-uniform transmission and time-consuming process of reproduction of a virus-free population of the leafhopper make experimental transmission of BCTIrV troublous. Generation of an infectious clone is another strategy for efficient inoculation of BCTIrV to host without dependency on its natural insect vector. The aim of this study is comparison of pathogenicity of two infectious clones of BCTIrV (1.1 and 1.4 mer constructs) in several hosts and optimization of criteria for efficient reproduction of the vector for transmission of the virus.

The complete genome of BCTIrV was cloned in pBlueScript II SK (+) previously. Plasmid extraction from the bacterial cells was carried out using plasmid extraction procedure described by Kotchoni et. al. (24). The 1.4 and 1.1 BCTIrV infectious clones were made by joining 1029 and 308 kb fragments respectively to a unit length of BCTIrV genome. The infectious clones were agroinoculated to seedling s of sugar beet. DNA extraction from newly grown leaves of agroinoculated plants was performed using CTAB. Polymerase chain reaction (PCR) using specific primer pair for BCTIrV coat protein gene (CP) was carried out to identify infectivity of the constructs. To optimize the reproduction of Circulifer hematoceps in greenhouse conditions, Beta vulgaris, Solanum lycopersicum, Capsicum annuum, Nicotiana glutinosa, Sesamum indicum and Amaranthus retroflexus plants were used as hosts. To determine rate of reproduction of C. Hematoceps in greenhouse conditions, firstly optimum temperature for the leafhopper reproduction was determined, then C. Hematoceps population was counted at optimum temperature in 21, 45, and 60 days after release. In transmission test, an adult C. Hematoceps was used to transmit BCTIrV to sugar beet seedling.ResultSequencing data and RFLP pattern using EcoRI/XhoI restriction endonuclease were confirmed integrity of the 1.4 and 1.1 constructs. Four weeks after inoculation, BCTIrV was identified in newly grown leaves of sugar beet seedlings using PCR. Eight weeks after inoculation yellowing and leaf curling symptoms were generated on infected plants. Circulifer hematoceps was successfully reproduced on B. vulgaris, S. indicum and A. retroflexus in greenhouse. Moreover, S. lycopersicum, C. annuum, N. glutinosa were not suitable hosts for the leafhopper reproduction. The maximum, minimum, and optimum of daily temperature required for C. hematoceps reproduction was 34°C, 18°C and 29°C, respectively in a period of 45 days after the leafhopper release. Also, the best fitted host for C. hematoceps multiplication was A. retroflexus, however, BCTIrV was not infective in this plant. BCTIrV was successfully transmitted from pG-BCTIrV 1.4 and pG-BCTIrV 1.1 agroinoculated B. vulgaris plants to healthy sugar beet using C. hematoceps. Fifth weeks after the leafhopper feeding systemic symptoms of the virus were developed.

The curly top is a destructive disease of sugar beet which is a threat to sugar beet production. Previously, several BCTIrV infectious clones with different lengths were made by other researchers. The pG-BCTIrV 1.4 is similar to constructs of previous studies. In this study, pG-BCTIrV 1.1 that is the smallest infectious construct of BCTIrV with a length of 3153 nucleotides, is successfully constructed for the first time. The 1.1 mer infectious clone will provide a facility for induction of point mutation in the BCTIrV genome to identify the role of genetic elements in virus pathogenicity via reverse genetic approach. The results indicated no significant difference in infection efficiency, symptoms severity, and vector transmission rate between pG-BCTIrV 1.4 and pG-BCTIrV 1.1 constructs. Forth weeks after inoculation symptoms were observed in B. vulgaris plants that vector transmission by pG-BCTIrV 1.4 and pG-BCTIrV 1.1, but Taheri et. al. (2012) represented symptoms appearance at two weeks post inoculation. This discrepancy may cause by differences in host susceptibility, virulence of the virus, or environmental conditions. The results revealed that, the preferential host for C. haematoceps multiplication was A. retroflexus in greenhouse conditions. The population of C. haematoceps increased up to 11.1-fold on this plant in 45 days. In the current study, infectivity of BCTIrV in A. retroflexus not identified either using agroinoculation or vector transmission, but Jahanbin et. al. (2015) represented BCTIrV infection in 20 % of agroinoculated A. retroflexus plants.

Squash Mosaic Virus (SqMV) is a Comovirus that infects many cucurbit crops worldwide. In this study, the first two complete genome sequences of SqMV (BSQ and TSQ) from Iran were determined. The RNA genomes of isolates BSQ and TSQ were, respectively, 5,754 and 5,755 (RNA1) and 3290 and 3271 (RNA2) nucleotides (nt) in length, excluding the 3'-terminal poly (A) tail. RNA1 of both isolates encodes a single polyprotein of 1858 amino acids (aa). The identity between the two Iranian isolates (BSQ and TSQ) was 94.24% nt and 94.82% aa for RNA1 and 88.80% nt and 89.50% aa for RNA2. In comparison to other SqMV isolates, BSQ and TSQ shared the highest nucleotide sequence identities of 95.12 % to 93.56 % (RNA1), and 87.59 % to 87.19 % (RNA2), respectively, with the Spanish isolate (RZ-SqMV). Phylogenetic analysis based on complete genome sequences reveals that SqMV isolates cluster into three distinct groups. BSQ was clustered alongside a Spanish isolate in one group and TSQ was separately clustered with a Chinese and US isolates in another group. Recombination analysis revealed that BSQ (RNA1, 2) and TSQ (RNA2) were putative recombinants. BSQ had 6 recombination sites within 5'-UTR, helicase, protease, RdRP (in RNA1), SCP and 3'-UTR (in RNA2) regions, whereas TSQ had 4 recombination sites within 5'-UTR, MP (two breaking points) and LCP region.

For the first time, the nearly complete genome sequence of onion yellow dwarf virus (OYDV) was found in Iran from garlic (Allium sativum L.) by deep RNA sequencing. Complete coding sequence of the Iranian isolate of OYDV (MN528769) consists of 10,212 nucleotides (nt), encodes a polyprotein with 3,403 amino acids (aa). Pairwise sequence comparisons showed that IR-Kh2 shares 74.84-97.39% identity at the nt level and 75.67-98% identity at the amino acids level, respectively with other OYDV isolates deposited in the GenBank previously. According to the phylogenetic analysis, the OYDV isolates were divided into two main groups based on the coding sequence of genome and the Iranian OYDV isolate cluster together with the Australian (MS/SW1), Spanish (SG1), Chinese (G78 and G37-2), and Indian (RR1) isolates. Furthermore, a genetic recombination analysis was also performed, in which a putative recombination event was detected in the nuclear inclusion body b (NIb) gene.

The root-knot nematodes of the genus Meloidogyne are highly adapted, obligate plant parasites, consisting of nearly one hundred valid species, and are considered the most economically important group of plant-parasitic nematodes. The control of root- knot nematodes has been sought by the use of nematicides, resistant varieties, crop protection and organic amendments. Because of toxicity of nematicides for environment, human health and wild life, application of them are restricted. Identification of genes responsible for resistance to root-knot nematode and their mode of actions have attracted a lot of attentions to develop resistant cultivars. Resistance in the plant species is often due to the presence of specific genes. In resistant cultivars, resistance genes can prevent or suppress one or more stages of nematode infection cycle. In fact, in response to nematode infection, resistance genes can prevent or suppress one or more stages of nematode infection process. In the most incompatible interactions, depending on the mechanism of resistance, the root galls are reduced or eliminated at the sites of infection. Assessment of resistance to the root-knot nematodes in different tomato cultivars is helpful for selection of suitable cultivars with satisfying plant growth and nematode tolerance traits for suitable management of the root-knot nematode. Thus, in the present study we evaluate the response of some tomato cultivars for resistance to root-knot nematodes, Meloidogyne javanica, in greenhouse conditions.

In this study, the nematode population was obtained from roots of tomatoes collected at a glasshouse in Tirtash–Mazandaran, Iran.The root-knot nematode were purified and multiplied on tomato cv. Early Urbana plants. Then the nematode species were identified based on morphological and molecular methods. The seeds of ALYSTE F-1, ARYZA F-1, Rutgers, Early Urbana, Dutch Mobil and Hungarian Mobil tomato cultivars were spawned in equal proportions of cocopit, perlite and vermiculite and irrigated for 3 weeks. Then, the seedlings were transferred to the pots containing mixture of sterile soil, sand and vermiculite (1:1:1) with 9 cm diameter. After 2 weeks, the seedlings were inoculated with 3000 second stage juveniles (J2s) of M. javanica. The pots were kept for 70 days at 24-33°C and 50% relative humidity. Resistance evaluation was based on plant growth and nematode reproduction indices. Growth indices were fresh and dry weight of root and aerial part, root length, plant height and total fresh and dry weight and nematode reproductive indices were number of galls and egg masses/g root and total root, eggs/egg mass, eggs/root, J2s /soil, final nematode population and reproduction factor (RF) were measured and recorded. The experiment was carried out in a completely randomized design with 5 replicates in the both of inoculated and non-inoculated with nematode. Data were analyzed in Minitab version 17. The means were compared by using Fisher,s LSD. Also to determine the resistance level, resistance index (RI) and reproduction factor (RF) were calculated. The RI is depended to frequency of the gall and egg mass index in the root. To determine Gall Index (GI) and Egg mass Index (EI), 0= no galls or egg masses, 1= 1 to 2, 2= 3 to 10, 3= 11 to 30, 4= 31 to 100 and 5= more than 100 were considered, in the following for RI, 0-0.9= immune, 1-1.9= highly resistant, 2-2.0= resistant, 3-3.9= moderately resistant, 4-4.9= intermediate, 5-5.9= moderately susceptible, 6-6.9= susceptible and more than 7= highly susceptible. The reproductive factor (RF) of the root-knot nematode in the different genotypes was obtained by dividing the final and initial population densities of the nematode (RF = Pf/Pi).Thus, RF≤1, GI≤2 = resistant; RF≤1, GI>2= moderately resistant; RF>1, GI≤2= tolerant and RF>1, GI>2 susceptible.

This study results showed that ALYSTE F-1, had the lowest number of gall, egg mass, second stage juveniles and consequently the lowest nematode population and was recognized as moderately resistant cultivar. In terms of the growth indices, ALYSTE F-1 also had the highest growth characteristics and contained a significant difference with other cultivars. Totally, Rutgers, ARYZA F-1, Dutch Mobil, Hungarian Mobil and Early Urbana varieties were introduced as highly susceptible cultivars based on RF and GI. However, Dutch Mobil, Hungarian Mobil and Early Urbana had the highest nematode population and reproduction factor (RF). In terms of the growth traits, the results showed that Rutgers, as a highly susceptible cultivar, was more impressible than other cultivars followed by Dutch Mobil. The cluster analysis based on the sum of the plant growth and nematode reproductive traits showed that ALYSTE F-1 cultivar was distinct from the other cultivars. Thus, the cluster analysis confirmed the results of comparison of the average of the plant growth and nematode reproductive traits.

Based on the results of this study, ALYSTE F-1 was identified as a moderately resistant cultivar to the root- knot nematode, M. javanica. and the others were highly sensitive to the nematode.

Among legumes, soybean [Glycine max (L.) Merr.] is an important plant that grown throughout the world. There are many pathogens that reduce soybean yield. Plant viral diseases cause serious economic losses in many major crops by reducing yield and quality. Soybean mosaic virus (SMV) is amongst important pathogens that infect soybean. Plants use resistance genes against the invasive pathogens. The identification mechanism is based on gene-for-gene hypothesis. Plant resistance (R) genes direct recognition of pathogens harboring matching avirulent genes (signals) leading to activation of host defense responses. It has long been hypothesized that under selection pressure the infidelity of RNA virus replication together with large population size and short generation times results in emergence of variants (mutants) capable of evading R-mediated recognition. Four R gene including Rsv1, Rsv3, Rsv4 and newly Rsv5 have found in soybean operating against SMV.

In this study, Rsv1/Soybean mosaic virus (SMV) pathosystem was used to investigate this hypothesis. Infectious cDNA clones of SMV-N (pSMV-N) and SMV-G7 (pSMV-G7) inoculated biolistically on Essex (rsv1) and SMV-G7d (pSMV-G7d) on Williams82 (rsv1) served as the sources of parental viruses. Sap containing viral progenies in 50 mM phosphate buffer, pH 7.0, derived from the infected tissues of biolistically inoculated Essex (rsv1) and Williams82 (rsv1) served as inoculum to mechanically inoculate carborundum-dusted primary leaves of other soybean genotypes. Soybean genotypes containing alleles of Rsv1 were inoculated with SMV strains N, G7 and G7d. Soybean genotype Williams82 (rsv1), susceptible to all strains of SMV and Rsv1-genotype soybean PI96983, Kwanggyo (Rsv1-k), Marshal (Rsv1-m), Ogden (Rsv1-t), Raiden (Rsv1-r), Suweon97 (Rsv1-sk) and Touson50 (Rsv1-n) were used in this study. All soybean seed were obtained from field-grown plants shown to be free of SMV by indexing. The inoculated plants were maintained in a growth chamber operating at 22°C with a photoperiod of 16h light and 8h dark. After twenty one days of post-inoculation, plants were examined by indirect ELISA and RT-PCR. Nested PCR was done and after Sanger sequencing of PCR products, results were analyzed by using Finch TV and MEGA7 software. Total RNA was isolated from top fully-developed systemically infected trifoliate leaves using an RNeasy Plant mini kit (Qiagen) as instructed by the manufacturer. RT-PCR was done in the presence of Superscript reverse-transcriptase III (Invitrogen) as instructed by the manufacturer. Nested PCR amplification of the entire HC-pro and P3 cistrons was done using two pairs of primers, SMV-239s / SMV-3910a and SMV-482s / SMV-3840a, in the presence of EX Taq polymerase (Takara Bio). The resultant amplicons were purified with a QIAquick-PCR Purification Kit (Qiagen) or MinElute® PCR Purification Kit (Qiagen) and sequenced using primers SMV-1468s, SMV-1614a, SMV-2289s and SMV-2916s. Sequencing was done at The University of Tennessee DNA Sequencing Facility.

One out of ten York and Kwanggyo plants and two out of thirty Ogden plants inoculated with viral progeny derived from the reproduction of soybean mosaic virus strain N complementary DNA (c-DNA) molecule on susceptible soybean plants, which was cloned in the laboratory (molecularly cloned SMV-N or pSMV-N) showed viral symptoms and were positive in indirect ELISA. In mechanical inoculation using the sap from these plants, the virus was again transferred to York, Kwanggyo and Ogden plants and subsequently was adapted to these plants. After performing RT-PCR test and determining the full-length sequence of the HC-Pro (Helper Component-Protease) and P3 cistrons of the virus, the position of the point mutation and the amino acid encoded by the nucleotide exchange at the mutation point, using MEGA7 software, was identified. In York and Kwanggyo plants, a point mutation was observed in the HC-Pro whereas in the Ogden plant in the P3 cistron.

The evolution of viruses is unavoidably linked to the evolution of their hosts. Due to the mutations in virus genome and the breakdown of resistance of various soybean genotypes, as well as the fact that the genome of the soybean mosaic virus is RNA type and the possibility of mutation is high, it can be a warning sign for plant breeders producing soybean plants with resistance genes to different strains of the virus. RNA viruses apply all known mechanisms of genetic variation to ensure their survival. Also, the intersection of resistant and susceptible genotypes and the study of the allele of resistance genes can be effective in producing resistant genotypes. The identities of different Rsv genes need to be revealed and the key components in SMV resistant signaling pathway need to be identified. So, a good breeding-for-resistance strategy would aim to develop cultivars with resistance against a wide range of strains of SMV. Transgenic soybean lines expressing part of the P3 and HC-Pro genes have been showed a stable and enhanced resistance to several strains of SMV and have the potential to significantly increase soybean yield.

Production of virus-free stocks is crucial for efficient management of plant viruses in cultivation of pome fruits. Regarding the importance of producing the pre-basic stocks of valuable fruit trees, pear cultivar ʽNatanzʼ, an important local pear cultivar in Iran, was selected for virus eradication. In the present study, tissue culture combined with in vitro thermotherapy and thermo-chemotherapy techniques were used for elimination of Apple Stem Pitting Virus (ASPV) and Apple Mosaic Virus (ApMV). In thermotherapy approach, in vitro shoots were initially incubated for 55, 60, 65, and 70 days in alternating temperatures (32/38°C), then, meristems were cultivated on meristem medium. In thermo-chemotherapy approach, in vitro shoots were incubated for 50 days at 32/38°C, and then meristems were cultivated on a medium containing ribavirin. Virus detection by RT-PCR using specific primers was carried out after rooting and adaptation of the regenerated shoots. The percentage of survived shoots and meristem establishment were depended on thermo-duration. After 55 days, 83.33% of shoots survived, while it decreased to 33.33% after 70 days. Both ASPV and ApMV were eliminated after 60 days of thermotherapy. Ribavirin at 10 and 20 mg L-1 reduced the percentage of meristem establishment to 50 and 37%, respectively, compared to the control (88.88%). Thermo-chemothery was also effective for ASPV and ApMV eradication from pear shoots.

 Squash mosaic virus (SqMV) is a member of the genus Comovirus in the family Comoviridae. It is a seedborne and beetle-transmitted virus infecting most plants in the genera Cucurbita and Cucumis. Like other comoviruses, SqMV has a bipartite positive-strand RNA genome consisting of RNA1 and RNA2, which are separately encapsidated in isometric particles of 28 nm in diameter. The genomes contain a poly (A) tail at the 3-terminus and the genome-linked viral protein (VPg) attached to the 5end. ELISA has been used widely in plant virus diagnosis but it has relatively low sensitivity which is not suitable for detection of trace amounts of the virus in single viruliferous aphid vectors and mix infection. By contrast, PCR is an effective and efficient tool for in vitro amplification of DNA templates and has been extensively used for the diagnosis of viral and subviral pathogens with DNA and/or RNA genomes. The polymerase chain reaction (PCR) and reverse transcription-PCR (RT-PCR) are powerful tools for highly sensitive detection of plant viruses with DNA and RNA. The first step in a successful PCR test is to have an extraction method and the major problem in RNA extraction is contamination by polyphenols and polysaccharides. So, in this study, we investigated the effectiveness of various extraction methods in identifying the Squash mosaic virus.

Plant material and virus isolates RT-PCR and sequencingTwenty-five samples of Melon from Khorasan Razavi and Jonubi provinces under the cultivation of Melon have been collected in spring and summer of 2017. The samples had typical virus types, severe mosaic spasms, complexity and deformity, and entered the process of extraction of the genome of the dandruff as a positive example. The leaves samples were used for different RNA extraction methods using Chang et al. method, Dena Zist and Qiagen Kit, Triasol and dsRNA cellulose method and were used directly or stored at minus 70 0C.Two specific RT-PCR was set up for amplifying an amplicon of 1900 and 1300 bp in order to detect infected samples, as this region is conserved among all SqMV isolates, and determine the best method for extraction virus RNA. The SqMV partial coat protein gene and partial genome of RNA1 has been sequenced to confirm the results. Here, we employed the Chang et al. procedure which is based on CTAB buffer. We also followed the manufacturer's protocol to extract the genome by Dena Zist and Qiagen kit. Triasol is a mono-phasic solution of phenol and guanidine isothiocyanate. It is a ready-to-use reagent for the isolation of total RNA from cells and tissues. After addition of Triasol and chloroform, phase separation is created by centrifugation. RNA is present in the aqueous phase and can be recovered by precipitation with isopropanol or ethanol. The extraction protocol used for DsRNA is a modification of the non-phenol batch protocol reported by Morris et al. (1983) and was compared with two other dsRNA extraction protocols.

 The destruction of the nucleic acid during the process of extracting from the plant tissue and the presence of inhibitory substances are the major problems in purifying the genome of the viral viruses. In order to effectively detect Squash mosaic virus from melon tissue at the contaminated fields, four RNA extraction methods were compared and then the nucleic acid extraction method was optimized. The quality of the nucleic acid was extracted by polymerase chain assay with reverse transcription and using two pairs of different primers. Among the methods of extraction, there were significant differences in the way that some of the methods were not able to detect the virus from the plant tissue. Among the investigated methods, the method of extracting dsRNA with cellulose resulted in the highest and most excellent nucleic acid due to the exclusive purification of the viral genomic from the plant tissue, making it possible to detect the virus in most of the samples. We concluded that the modified dsRNA extraction protocol is efficient, fast, economic, versatile, and requires small amounts of tissue. The protocol was successfully used to extract dsRNAs from the plants infected with acute and persistent viruses such as SqMV in Melon samples.

The common cutworm, Agrotis segetum, is a serious soil pest of many vegetable and field crops all over the world. Morphological identification of Agrotis species is predominantly performed on adults due to the deficiency of adequate identification keys for immature stages. In international trade, the immature life stages are frequently being intercepted at point of inspection, challenging the possibilities of morphological identification. To realize a rapid and reliable identification for all stages of A. segetum, a TaqMan real-time Polymerase Chain Reaction (PCR) was developed based on the mitochondrial Cytochrome Oxidase I (COI) gene. All specimens of A. segetum (including various life stages) were detected and no cross-reactivity was observed with 5 non-target Agrotis species in the specificity tests. The tests showed to be repeatable, reproducible, and robust. The assay performed equally well with crushed insects and purified DNA, so, the efficiency was added by removing DNA extraction step. The method has proven to be suitable tools for routine identification of all life stages of A. segetum considering the speed, specificity, as well as sensitivity of the assay.